The I Ching and the Number 5

 

Here we see the I Chiing if we added in the extra rows marked in red for the number fives.  The green or wooden cross contains the Tree/Air elements…….yellow is all Earth, Lilac is all Metal and the combinations contain both……..the blue lines denote the fire and water elements of the chart. 

So as we know number five has a habit of being nothingness or invisible…..

So we still have the appearances but the red cross at centre is now clear it simply does not exist. Is the five within? 

Enjoy your thinking x 

The Number 5 in Nine Star Ki and The I Ching

 

In the I Ching based on 2814976 we have four quadrants top left C Water - Top right T Fire

The bottom left hand side A Earth - bottom right hand side G Air/Tree……here we take a closer look at the top left hand quadrant of Water Cytosine.

Each of the 16 sections contains a dominant or centre number from a Bagua. So CCC DNA Codon 2/2 Nine star ki gets the ball rolling. 2/2 is at the centre of the Bagua and when a double number is at the centre ALL of the numbers become doubles. So a powerful Bagua indeed associated with the Grand Trine in Water. All double numbers in an I Ching map move from the left to right in a diagonal line. So we see the four double number Baguas here are 2/2 - 8/8 - 1/1 - 4/4. The number 5’s in these Baguas are removed leaving just 8 Nine Star Ki numbers in the Bagua. All of the 5 numbers removed in a centre pack are 5/5.

The red oblong shape denotes the numbers that will be changed into double numbers for example 2/8 at the centre changes its 8/5 into 2/2……2/1 at centre changes its 6/5 to a 4/4 and so on. The green cross shows the excluded square that is now empty. 

In this section of The I Ching NE/SW and SW/NE seems to dominate here. 

So any number 5 in a Bagua is amended to read and alternative number if 5 is the first or year number it is cancelled out altogether but the 5 in the month or second number will change it to a double number. 

Lets look at the first 5 and second 5 and compare it to the double number…….

Centre number 22 first and second are 5 and 5.

52 cancelled    85 - 22 **

54                    55 - 44

57                    35 - 77 **

58                   25 - 88 **

Centre number 88 first and second are 5 and 5

 51                    95 - 11

56                    45 - 66

53                    75 - 33 **

Centre number 11 first and second are 5 and 5 

59                    15 - 99

Centre number 44 and second and first are 5 and 5

So lets take an example of a Bagua with 5/7 cancelled…..

So the North East corner is missing and the North West corner has been changed from 35 to 77…

My own 1/7 Nine Star ki is as follows…….

Solfeggio number 5’s will need change too I wonder if the Gregorian Monks realised that the number 5 does not exist in The I Ching……….and yet 5’s in solfeggio balance our DNA beautifully….. perhaps they had to change and adapt too. Enjoy your thinking x 

The I Ching and DNA Codons relationship with the Number Five

 

Here we have the directions map - 8 sections N/S - NE/SW - E/W - SE/NW - all 8 directions each containing numbers 1 to 9 ………………….the image at the top shows which Nine Star Ki fits into which section. Double numbers have been placed at the centre of each of the Baguas….you will notice there are no number fives here. The number 5’s appear to match with a single number and doubling it. For example 1/5 becomes 9/9 ……9 being the opposite to number 1……… so each number with a 5 becomes a double number which always sits at the centre of the lower edge of the bottom map. 

Note also how each of the sections in the Bagua have a missing portion ……again the numbers contain that five and thus are not required. Each Bagua would have number 5 appear twice and each time they are either removed or cancelled out and the other one becomes part of the double number. The five that is the month number is associated with the double numbers and the one that has 5 as the year number is removed altogether.

So the 9 sections of 9 that we usually know = 81 parts but the middle section of 9 is missing here and one from each of the other 8 panels is missing so…..

    81 - 9 - 8 = 64 DNA Codons or I Ching Hexagrams. 

The missing numbers from each of the 9 boxes above are as follows….

                       6/5            1/5            8/5

                       7/5            —            3/5

                       2/5           9/5           4/5

In the I Ching and with DNA Codons none are made from the number 5 but in Solfeggio music the number 5 is present ……..birthdates can create number 5 years and months and when they do they will need to be changed to either an 8 or a number 2. The nine Baguas also contain the number 5 twice in each section I give below an example of my own……

                                                                    96            52            74

                                                                    85            17            39

                                                                    41            63            28

 

We would look at this bagua as 5/2 in the South position would be removed and the 8/5 position would be amended to read 8/2 that way each number appears twice but number 5 does not appear at all. 

8/5 has no I Ching Hexagram but 8/2 can now become Hexagram 15 which also has a North East sitting South West Facing direction. DNA Codon CCA. 

Obviously you need to check each variation on the five as it may become 8 or 2 depending on the count.

Imagine North South 1/1 and 9/9 and notice they have numbers opposite to each other as each falls into the centre they cancel each other out. 

More work to be done here but I have long wondered about the purpose of the number five. Enjoy your thinking. X 

DNA Codons - Nine Star Ki Directions

 

Each section of this direction map has nine star ki numbers 8 times…….there is no mention of the number 5 in this map or indeed in The I Ching. 

North and South go together as do 1 and 9 lets see what other patterns we can find between all the numbers…..

North/South 1 & 9…from outer to centre…

ATG    9.4 interestingly the start point being North and it begins with Methionine or MET the Start Button…..and its pairing is the STOP button TAG. So does everything begin in the outer north position and end there once more. 

ATG            9/4        4/9        TAG - STOP and Start Met ATG

TCA            8/3        3/8        ACT

AAC           7/2        2/7        TTC

AGA           6/1        1/6        TGT

No. 5           5/9        9/5        No 5

CAG           4/8        8/4        CTG

GTC            3/7        7/3        GAC

TTT             2/6        6/2        AAA

No. 5           1/5        5/1        No.5

GCG           9/9        1/1        CGC

So observations here are that the number five positions contain the numbers 1 and 9 and they become the double numbers at the centre of the map. They do not appear as fives but as 1 or 9 in this case. The nine star ki that sit in the North and face South are to the left hand side and the Nine Star Ki that sit in the South and face North are to the right. As they flow into the centre of this map they cancel each other out. This is so often the case in The I Ching at the end of the day there is nothing to see because everything has been cancelled out. 

North East/ South West 2 & 8…from outer to centre…

GTG            9/6        6/9        GAG

No.5            8/5        5/8        No.5

AGT            7/4        4/7        TGA * STOP

GAA            6/3        3/6        GTT

No.5            5/2        2/5        No.5

CGA            4/1        1/4        CGT

GCT            3/9        9/3        GCA

CCT            2/8        8/2        CCA

TGC            1/7        7/1        AGC

CCC            2/2        8/8        CCG

The same patterns apply here the number 5’s are associated with the double numbers 2 and 8. The thing about this one we can see that in nine star ki an 8/5 and 5/8 will become and 8/8 and the 2/5 and 5/2 will become 2/2 this is useful information in the Bagua when we come up against number 5 and are not sure if it will become a 2 or an 8 in this case we know. 

East/West 3 & 7… from outer to centre…

ACA            9/2        2/9        TCT

CTA            8/1        1/8         CAT

GAT            7/9        9/7         GTA

AAG           6/8        8/6        TTG

No.5            5/7         7/5        No.5

TGG            4/6        6/4        AGG

No.5            3/5        5/3        No.5

CTT            2/4        4/2        CAA

TAC            1/3        3/1        ATC

GGC           7/7        3/3         GCC

The number 5’s here are connected to 7 and 3 but we cannot determine whether 5’s would become 2 or 8 maybe we should just accept them as becoming part of the double numbers. So in a Bagua 5/7 would become 7/7 etc.,

South East/North West …from outer to centre…

ATA            9/1        1/9        TAT

TCG            8/9        9/8        ACG

AAT            7/8        8/7        TTA

GGA            6/7        7/6        GGT

No.5            5/6        6/5        No.5

No.5            4/5        5/4        No.5

ATT            3/4        4/3        TAA - STOP

TCC            2/3        3/2        ACC

CAC            1/2        2/1        CTC

GGG            6/6        4/4        CGG

Again the number fives only connect to 6 and 4 or the double numbers. 

Lets look more closely at the numbers 1 and 9 North and South…..

This gives us a closer look at the codons that move North East to South West and South West to North East…

We place the middle number at the centre in this case 2/5 made into a 2/2 and 8/5 made into an 8/8. Each of the 12 months of the year are represented and the decision to change the fives into either 8 or 2 is made in order to make sure all months are represented. So we see how the centre numbers with their placement of number 5 determines that five is indeed the centre. The five will be changed into either 2 or 8. 

I will return to this with proper maps for each set of directions and pairs of numbers. Enjoy your thinking. X

Solfeggio and Nine Star Ki I Ching Connections

 I cannot help but see the I Ching 28143976 across the top and down the sides as though the year number e.g. 1 Water Blue floats by in a horizontal way and the month numbers vertical line floats by to make the negatives picture much clearer…….my own 1/7 is third row down Blue 1 water and 7th row down in the vertical…….creating a red vertical line for the month and a blue dot at the centre for the year number. 

In Solfeggio music the Month number also seems to be the dominant……

Feb/Nov born    8 5 2

Mar/Dec            7 4 1

April/Jan           6 3 9

May                  5 2 8

June                  4 1 7 

July                   3 9 6

August              2 8 5

Sept                  1 7 4

Oct                   9 6 3

Early dates of each month can vary and belong to the month before but the majority work to this rule. 

So my 1/7 Nine Star Ki is now represented as a vertical red line with a dot of blue in it alternatively it could be a blue horizontal line with a red dot in it or a cross where both vertical and horizontal cross over. My Solfeggio for those born in March is 741…….all about communication and the throat chakra. There is so much more to us that just our date of birth can tell us. Enjoy your thinking. X 

The 64 Bagues and Their Directions and relationsbip to number 5

 

Here we see the Directions Map of Nine Star Ki and The DNA Codons of The I Ching. I am focussing on my own 1/7 Bagua to show how all codons and Nine Star Ki in any Bagua will ALL take the same direction as the centre code. 

96 - GTG     52 - X         74 - AGT

85 - X          17 - TGC     39 - GCT       All of these Nine Star Ki sit in the North East and Face South West

41 - CGA    63 - GAA    28 - CCT 

If you look to the marked section above all of these codes are in this same section. Starting on the outer edge with GTG. The codes that contain number 5 do not appear 5/2 becomes 2/2 CCC and 8/5 can only become 8/2 which does not appear in this section. CCA 8/2 appears in the opposite side of South West. 2/8 appears in the S.W. Side as 5/8 but shows in the North East side. So perhaps those 5’s are happier in their opposite position. 

So all 64 codons can appear at the centre of a Bagua and then all the other Nine Star Ki will face the same direction as the centre partnership. 64 codons 8 in each of the 8 sections. 

Enjoy your thinking. X 

One Moment in Time Read differently and in Many Ways

 The Aspect shapes that can be found in my birthchart based on the letters in DNA Codons……

Not all shapes in your chart can make a DNA Codon they have to have a planet in Aries, Taurus, Gemini or Cancer as a starting letter. The second letter will be found in Leo, Virgo, Libra and Scorpio and finally the third letter would be found in the signs Sagittarius, Capricorn, Aquarius and Pisces. 

So for me that creates the following triangles as follows…

TTT - Grand Trine in Fire - 120 x 120 x 120 -  Phenylalanine - Hex 12 - Directions North to South - 6/6 - 2/2 Crystal - Musical Notes - C E G# - Planets Saturn and Venus - Nine Star Ki 2/6 - 

Hydrophobic

TTC - Thinker - 120 x 150 x 30 - Phenylalanine - Hex 45 - Direction South to North - Double Crystal - Musical Notes

C E B - Saturn Venus - Nine Star Ki 2/7 - Hydrophobic

GTT - Alternator - 60 x 120 x 180 - Valine - Hex 25 - Direction South West to North East - Double Crystal - Musical Notes D E G# - Jupiter Venus - Nine Star Ki 3/6 - Hydrophobic 

GTC - Teacher - 60 x 150 x 90 - Valine - Hex 17 - Direction North to South - Diamond Crystal - Musical Notes D E B - Jupiter Venus - Nine Star Ki 3/7 - Hydrophobic 

GGT - Alternator - 120 x 60 x 180 - Glycine - Hex 10 - Direction North West to South East - Double Crystal - Musical notes D F# G# - Venus Venus - Nine Star Ki 7/6 -  Neutral 

GGC - Lecturer - 120 x 150 x 90 - Glycine - Hex 58 - Central direction - Double Crystal - Musical Notes D F# B - Venus Venus - Nine Star Ki 7/7 - Neutral 

CTT - Thinker - 30 x 120 x 150 - Leucine - Hex 20 - Direction East to West - 6/6 - 2/2 Crystal - Musical Notes D# E G# - Saturn Jupiter - Nine Star Ki 2/4 - Hydrophobic 

CTC - Thinker - 30 x 150 x 20 - Leucine - Hex 8 - Direction North West to South East - 8/4 - 7/3 Crystal - Musical Notes D# E B -  Nine Star Ki 2/1 - Hydrophobic 

Four of them are Number 2 Nine Star Ki……….2 are Nine Star Ki 3…..2 are Nine Star Ki 7 …….

2 3 7

Aspect Shapes 1 x Grand Trine - 3 x Thinker - 2 x Alternator - 1 x Teacher - 1 x Lecturer 

2 x Phenylalanine - 2 x Valine - 2 x Glycine - 2 x Leucine 

Directions….. South to North  

North to South x 2

     South West to North East 

North West to South East  x 2

Central 

East to West 

Crystals 6/6 - 2/2 x 2

Double x 4

Diamond x 1

8/4 - 7/3 x 1

Musical notes ….. C D D# E F# G# B……

Missing notes…..       C# F G A A#…..

Planets Saturn - Venus - Jupiter 

Hydrophobic x 6 - Neutral x 2

TTTTTCGTTGTCGGTGGCCTTCTC…………..Hmmmmm I wonder what I can create from that little lot. The Grand Trine in Fire is much appreciated I get some time to relax at least. Perhaps I can be creative in inspirational ways. Three Thinkers wel I guess this blog explains that to be the case……two Alternators busy or lazy depending on my mood……….and finally the three tone Lecturer which when combined three colours Red, Blue and Green create white light……so big lessons to learn from here but stay in the light and all will work out well. 

So I will go off and throw some shapes today and hope they come together and create something wonderful. Enjoy your thinkiing. X