Map 609 Think on these things - Once Your Awake

Once Your Awake

Once your awake its difficult to return to sleep,

Your no longer tired but ecstatic,

No need to switch on the light,

The Path is lit for you.

Once your awake your dreams can come true,

Spread the light of your awareness,

Let there be no separation,

Praise the day when you’re praying to yourself.

Once your awake let there be an end to fragmentation,

No more duality just reality,

All contained in unity,

You know who you are, others can too.

Once your awake so is your sense of community,

Together united visionaries,

The light of the world for all to see,

A vision of you that’s reflected in me.

Once your awake you realise life is a homeopathic experience,

Every thought, never to be forgotten,

Visions relived over and over again,

Until the spring in your Jack in the box has broken.

Once you’re awake Jack and Pandora can be married,

All hell need no longer break out,

You are free to express yourself,

Without need of drama.

Once your awake the unknown is known,

Being awake comes after sleep,

And beauty has been awakened,

In my Romantic world there is always a happy ending.

Map 608 The Sound of me in G Major - DNA of TGC - 1/7/8 Nine Star Ki - Hex 47

The Sound of Me

As I am sure you are aware by now I was born on the 15^th, March, 1954.

This makes me a Pisces, with a Nine Star Ki of 1 – 7 – 8.

I belong to the 1/1 – 9/9 Crystal.

Hexagram +47 in the I Ching.

I sit in the North East position facing South West as my best direction.

My DNA letters are TGC, which belongs to the astrological 1^st, 7^th and 12^th houses.

My musical tones are C, F#, B which makes the sound of me to be G Major.

Having looked at a website for sounds on www.musicarrangerspage.com

I found the following information:

“Emotions of songs in G major”

What are some characteristic emotions of songs in the key of G major? Usually everything is of a traditional, beautiful and lyrical quality. Often there’s a tender thankfulness for genuine friendship and true love.
When we summarize this we can say that gentle and peaceful emotions are expressed by the person’s heart.
From this moment on by Shania Twain is an example of the emotions in G major in action there are others but you may want to log onto their website to read more.

My TGC - G Major nature enjoys a peaceful and gentle life not being a musician I would not like to say what a distorted G Major may sound like so I prefer to keep to an even keel for my Piscean waters.

Enjoy the sound of me. x

Map 607 The I Ching Hexagrams combined as pairs

This is DNA as it appears.

Flip the DNA once horizontally.

Flip the DNA once vertically.

Flip the DNA once horizontally.

Flip DNA to the Right.

and finally once over and to the left  again.



All six images of DNA.

The DNA I Ching in paired Hexagrams starting with a DNA or The Word chart with 28143976 across the top and down the sides so they are paired up as they appear. E.g. CCC top left matches GGG bottom right but the codon that appears first is positioned first. Working from the top left hand corner to the end. The boxes marked in red on their edges (4) are the DNA codons that I call alerts which do not conform to the usual pattern. They appear much more like the cubes or building blocks of life that they are when positioned this way with diamond shaped spaces between them. Squint your eyes and they begin to form spirals. 

 

Map 606 36 Triangles of DNA 24.4.2013

Well another attempt and many hours later I have another 36 triangles but not less, I am pretty sure by now that it cannot go any lower. Although when I made DNA into cubes it made 8 cubes which was lovely clumped together then I realised I could do them in four and that was some time later so I wont give up just yet. Let me know if you improve on it. x

Map 605 Another 36 Triangles of DNA

Another Measure of 36 Triangles

I have continued to play this game for some considerable time and have yet to beat this score of 36 so I am beginning to think 36 might be the smallest it can be. 64 Codons of 3 triangles is 192 triangles and to reduce that down to just 36 is quite remarkable in itself. Those 36 can still produce the 64 codons of DNA.

One thing this game shows us is that blockages or duplications can occur in DNA when you come across, as an example TAT it is very tempting to add ATA next to it but this is when the blockages occur as when you try to adjoin other letters to them you duplicate which in this game you cannot do so you then have a blockage, or position where nothing can be added.

Does duplication or blockage occur in 'real life' DNA.

I have had others play this game and nobody has yet matched my 36 score, in fact I have yet to find a score that when checked doesn't have duplications in it. It's got to have some kind of synaesthesia quality to it.

When you consider the study of Feng Shui it is about combining the elements in a destroy or create kind of way. Once a cycle is complete and the product produced to perfection the only thing left is to destroy it and start that cycle over again. Combination effects produce everything on the planet. In Feng Shui you have colours, numbers, letters, elements, shapes etc., all combining to produce perfection. This game has that synaesthesia effect you are trying to place down coloured triangles with letters on them and this can make it more difficult it would very likely be easier if letters were not mentioned and just coloured triangles were used. Or alternatively just letters were used on a transparent triangle. It is in the combining of the two that it makes the game more difficult.

In DNA music if your DNA is CGA all of these letters appear in the musical scale and when changing DNA from codons to musical notes A,C and G are often where the errors occur because when you see CGA you immediately think of musical notes C,G and A when in truth they would be D, F# and A so only A, Capricorn or musical note A remains unchanged.

The difficulty occurs is our ability to combine different qualities, colour, number, letter etc., Enjoy the process and do let me know if you improve on it. x

Map 604 The 1/1 - 9/9 Crystal as a Musical Sound

1/1 – 9/9 Crystal

In truth you could start at any point as long as you are playing the – Hexagram with your left hand that is one number up from the one you are playing with your right hand. I am starting at 1/1 - 9/9.....

Right Hand   D# F# B C F# B C# E A# C# E A D# E A D G G#

Left Hand     D G A# D# F# A D F G# C F G# C F B C# G A#

Map 603 So many Centres of The I Ching

Notice how the centre points change depending upon how many layers are present red dot is centre point in all cases remove one outer layer and the yellow dots mark centre, remove another outer layer the green square becomes centre, remove another outer layer and the orange triangle becomes centre. Could it be that as our ideas grow so do the layers until it can push that energy out into the world. Starting with just the four letters of DNA and pushing out to the 64 Hexagrams. Each set of 64 could then become one part of another even bigger set. Note the colours get stronger the closer to full growth of 64 they become. 

Don't you just love The I Ching x 

Map 602 the 1/1 - 9/9 Crystal and its weak link

Water is a strong focus of the 1/1 – 9/9 crystal as is fire. Therefore the watery blue of the diamonds sparkling in the fiery sun seems the ideal jewel to choose to make this particular bracelet.

Interesting to see that weak link. I wonder if all crystals have a weak link point. x

Map 601 The I Ching as Zero One's and The Field of possibility

The I Ching as Zero One's

	2	8	1	4	3	9	7	6
2	000000	000001	000010	000011	000100	000101	000110	000111
8	001000	001001	001010	001011	001100	001101	001110	001111
1	010000	010001	010010	010011	010100	010101	010110	010111
4	011000	011001	011010	011011	011100	011101	011110	011111
3	100000	100001	100010	100011	100100	100101	100110	100111
9	101000	101001	101010	101011	101100	101101	101110	101111
7	110000	110001	110010	110011	110100	110101	110110	110111
6	111000	111001	111010	111011	111100	111101	111110	111111

We have seen the I Ching as Hexagrams, Nine Star Ki, DNA Codons, Music, Amino Acids, Crystals, Planets and Aspects. Now we see them in a simple digital form.

The I Ching

The Hexagrams of the I Ching are so simple yet full of unborn potential. The

Field of all possibilities. One life form expressing itself in many different ways through us. God the Creator in Heaven GGG, the breath of God from which all is manifest. We the human elements on a normal level become observers and from those observations we create our lives and everything that's in them. Some are visionaries and can create things that have never been seen on Earth before. Whichever type we are nothing would manifest from this invisible field without our vision. Only our own levels inhibit the horizons we can create for ourselves. The nature of the celestial is above the horizon and our own acquired conditioning below. Breaking free of conditioning is the key to a better life carefree and happy and above all else our own creation not what might be expected of us. 

Is it possible that the very air we breath is The I Ching......GGG Tree/Air element the breath of life is a continuous  process throughout our lives?

If you listen to The Spice Girls record Viva Forever at the beginning there are five tones to the sound Aaaah then a breath which I presume to be The Breath of God exhaling, it is just beautiful little did I think I would conclude that breath to one day be The I Ching.

Map 600 DNA Codons Pattern of the I Ching in 36 letters Best score 11/4/2013

Map 598 I Ching and DNA Codons in a Map Current Best

This is the amended version of Solo Man's Temple showing all 64 Codons of DNA in this map of just 39 Triangles. I had thought I had done it in 33 triangles but noticed an error and have amended it.

There are 64 codons of DNA some of them can read the same backwards. For example TGC and CGT can be read in this map as being the same. TGT and other like it where the first and last letter are the same can only be themselves read in both directions. I have noticed that when you make up the map with these same beginning and end triangles they can form a blockage and make it more difficult to put down another triangle.

So see if you can improve on 39 and if you do please let me know.

Four triangles making up the 64 codons in sets of three. 4 x 4 x 4 = 64 reduced to 40 for repeats. 

CCC CCT CTC CTT TCT TTT

CCA CCG CTA CTG TCA TCG TTA TTG

CAC CAT CGC CGT TAT TGT

CAA CAG CGA CGG TAA TAG TGA TGG

ACA ACG ATA ATG GCG GTG

AAA AAG AGA AGG GAG GGG

This has now been reduced to 36 Triangles. I think this is as low as it will go x

Map 597 Nine Star Ki energies for the month of April, 2013

April, 2013

4/8 Tree/Air transmuting Earth - decreases Earth strength	9/4 Fire draining Tree/Air – decreases Tree/Air strength	2/6 Earth Supporting Metal - increases Metal strength
3/7 Tree/Air transmuted by Metal– decreases Earth strength	5/9 Earth draining Fire - decreases Fire strength	7/2 Metal draining Earth - decreases Earth strength
8/3 Earth being transmuted by Tree – decreases Earth strength	1/5 Earth transmuting Water - decreases Water strength	6/1 Metal supporting Water - increases Water strength

4 positions are decreasing the Earths energies. One position decreases Tree/Air. One position decreases Water. One position decreases Fire.

One position increases Metal. One position increases Water.

So Water has one increase and one decrease so remains steady.

Fire has one decrease so is not strong.

Tree/Air has one decrease so is not strong.

Metal has one increase so is stronger.

Earth has four decreases and is thus weakened.

So just by using this simple way of looking at the energies for April we can see Water remains steady and Metal is increasing thus is able to add a little to that steady Water by way of support.

This in turn can offer a tiny bit of comfort to Tree/Air which is not strong. Fire is not created from this as Tree/Air is not strong enough. In some ways this is good for Water as it has not got the strength to control Fire. Fire is weak and thus cannot support Earth which is very weak for the month of April.

Look to the energies the Earth can give us that we might be lacking this month. Tree is not holding the banks of Earth together or getting as much water as it likes, there is no fire to warm the Earth. Hence no fire and water for the Earth equates to no growth. We can see what that might be like in the weather we are currently having were spring has halted its progress and we are not getting the green growth we should at this time of the year. Its as though we are in suspended animation and until the Earth feels moist and warm enough spring just cannot get started. Lets hope May is kinder to the the Earth.

Earth weakest and Metal Strongest this month. So have some fun before the work begins.

The energy is moving from the North direction to the South during this month. Lets hope that does not bring war mongers out. Don't worry it will soon be May a warm S.W. breeze is just what we need to warm us all up. x

Map 596 Hexagrams and their Shadows

1/7 and 4/1 are shadows in the hexagrams too. Hex 47 and 48 all of 1/7 is moving from NE to SW and all of 4/1 is moving from SW to NE. As we know already 7 and 4 are interchangeable.

We can also see that the 1/7 boxes meet their reverse numbers in 1/4 and create the pattern we have seen before which I call Solo Man's Temple.

If 1/7 is exhaustion of waters it is rather nice that 4/1 is The Well – an inexhaustible supply of water which is its shadow hexagram. 1/7 Hex 47 - 4/1 is Hex 48. 1/4 is Hexagram 59. 1/7 moves NE to SW and 1/4 moves SW to NE. Hexagram 59 is Wind over Water so should you be experiencing any blockages to your progress the wind gently blows across the waters dispersing those blocks to your energy and releasing them.

So as a Hexagram 47 person I no longer need to worry about exhaustion when my shadow never leaves me and has inexhaustible supplies and should I become blocked by various of life's situations I have Hexagram 59 to gently disperse those blockages and help me to move on.

I feel that the shadow of Hexagram 59 cannot be ignored and that is Hexagram 60 – 7/1. Limitations, water over the lake gives limits because once the lake is full all it can do is overflow so setting a limit is required for this hexagram. Very much a story about water.

Map 595 DNA and The I Ching Alphabet

I Ching Alphabet

Digits	Letter	Nine Star Ki	Hexagram	DNA Letters
111111	A	6/6	1	GGG
111110	B	6/7	43	GGA
111100	C	6/3	34	GAA
111000	D	6/2	11	AAA
110000	E	7/2	19	AAC
100000	F	3/2	24	ACC
000000	G	2/2	2	CCC
000001	H	2/8	23	CCT
000011	I	2/4	20	CTT
000111	J	2/6	12	TTT
001111	K	8/6	33	TTG
011111	L	4/6	44	TGG
101111	M	9/6	13	GTG
110111	N	7/6	10	GGT
111011	O	6/4	9	AGG
111101	P	6/9	14	GAG
011110	Q	4/7	28	TGA
001100	R	8/3	62	TCA
000100	S	2/3	16	TCC
000110	T	2/7	45	TTC
010101	U	1/9	64	TAT
101101	V	9/9	30	GCG
101010	W	9/1	63	ATA
001001	X	8/8	52	CCG
001101	Y	8/9	56	TCG
110010	Z	7/1	60	AGC

TGGAGGGCGAACGTGAACTTCCCTGGGTTCTCCGGGTGGTGG

CTTGGGTCCTTGAGGACCTCGAGGTAT.

I have not left a space between the words as DNA has no spaces. Can you work out what I am saying and then tell me from which musical theatre production these words come.

This should keep the kids busy during the holidays. Leave them notes about the house that they have to work out for themselves before they get the rewards.

Have fun.

I have written in DNA letters you can use any of the above.

Map 594 Praise the Day

Map 593 The I Ching Hexagrams in just 39 Triangles

My best short cut so far. Showing all 192 triangles of DNA in the 64 hexagrams. 64 x 3 = 192

This pattern shows all 64 codons in just 39 triangles.

I am calling this game Solo Man's Temple as it has a soothing effect like solitaire does. There is no room for rumination with this game.

Have fun trying x 

Map 592 The Shrunken First Line of The I Ching

This is a section of triangles making up the hexagrams of the I Ching 8 hexagrams can be reduced to this. This is the first row 2 Earth through to 6 Metal. Ordinarily 8 hexagrams x 3 triangles would be 24. This is reduced to just 8 in total.