A plants man has an idea of what he wants to create and that is why he has selected the parent plants to fulfill that dream in the creation of the new born variant. If you choose a plant that loves to be in full sunlight plant it there. Don’t plant it in the bog around your pond, you have the genetic make up for success but by positioning it in the bog you are conditioning that wonderful creation to failure.
Consider the same problem in human form Elvis was genetically made to be beautiful, talented and creative but genetic variants he had meant his genetic inheritance was likely to mean he died young. Did Marilyn Monroe have similar variants, or other Iconic people. Or does talent that dies young become iconic afterwards. Can it be written in our DNA to be famous the world over, die a tragic early death and become iconic. I certainly hope not.
So our genetic parents are a part of the code that builds us and God or the plants man chooses those parents and builds The Code making us co-creators with God.
So next time you want to blame your parents for something remember God had a hand in it too, mistakes were made variants were built into your DNA more by error than judgement. Sometimes it’s not until you see the end product that you get to see where you went wrong. Love yourself and your variants because there is little you can do to change them. (at the moment anyway).
I love you just the way you are, wouldn’t it be nice if we stopped there. Most of us go on to say but if I could just get you to do this or change that you would be more perfect. Your parents and God created you just the way you are don’t allow others to come along and make adaptations, only you can change the way you are now. Nobody else. We are a work in progress and should improve not go backwards. To the future and beyond. x
A look at Astrology, Feng Shui, Nine star Ki, I Ching and then finally on to DNA. A look at all of these principles through patterns. These are my thoughts and I can give you no evidence but ask that you accept what you are comfortable with and disregard the rest.
Saturday, 29 March 2014
Tuesday, 25 March 2014
Map 870 In the Beginning was The Word, The Writing comes after
I often look at the I Ching Map The
Word based on the number positions 28143976 and wonder how this one
small map could have inspired me to write almost 800 articles on the
subject. After The Word 28143976 comes The Writing 63182497 and of
course having studied The Word I have now gone on to produce The
Writing literally within those 800 articles. I look at this map today
and am still amazed to know that if I decide to spend the day looking
at it once more I will still be able to find something new in amongst its
many layers. I am still amazed by it and suspect there is a lot
of mystery hidden in amongst its folds for me to find for many years
to come.
Monday, 24 March 2014
Map 869 Another Brick in the Wall of Nine Star Ki
Adornment – Pi – Grace.....the
ability to see with clarity just how beautiful the world is, a work
of art. The tranquility of pure contemplation. Illuminating the
beauty of form.
Exhaustion – Oppression from outside
forces, words cannot be trusted, turning inward you find that you can
trust yourself and success can come from your own efforts.
Perhaps living in a world contained within these walls one will no longer be oppressed by outside influences when they see the world and how is is formed more clearly, everything is art and of your creation, illuminate it and see it as it really is through contemplation and inner peace.
Coming out of exhaustion into a state of grace is how it is described on I Ching Meditations.
There is a meditation called wall gazing perhaps we should give it a try. x
Coming out of exhaustion into a state of grace is how it is described on I Ching Meditations.
There is a meditation called wall gazing perhaps we should give it a try. x
Map 868 DNA Saturnian style and Jupiterian Style in the Crystals
When we look at the X factor as its spread out across a page we see that it spreads out to produce the letters:
GCGATACGC
Just nine letters which colour in the whole page as a yellow, blue, yellow, green, orange, green, blue, yellow and blue line. 9 Letters 9 vertical lines of colour. If we consider this line to be a reduced, limited or Saturnian line of DNA we can expand it as follows jupiterian style as follows:
Saturn GCGATACGC becomes…
Jupiter GCGCGAGATATATACACGCGC
GCG = 1 codon then start at second letter and CGA can be created and so on until all 7 codons can be found that leaves 5 codons down one side of the crystal that do not appear.
GCT - CTA - TAT - ATG - TGC do not appear and yet as we can see above they are in there. So the crystal can be expanded to show 7 codons starting at the bottom GCG and ending at the top of the crystal at CGC. Perhaps this is showing only one side of the crystal.
So the crystal would appear as a stack of bricks with blue and yellow running through the centre of them with orange and green on the outside. Very different indeed.
Thursday, 20 March 2014
Map 867 The Recording of your life in DNA
This for me has been one of the most lingering images I have created whilst looking at DNA. All 6 crystals combined into one disc. The 6/6 crystal running around the outside edge. Or Heaven on the outer rim. My own 1/1 Crystal comes next, followed by the Double Crystal, the 8/4 Crystal and at the centre the smallest of them all the Diamond Crystal. As the needle progresses across the disc it moves us around our own crystals by dividing the year into twelve. Each house or section being a month. My own TGC belongs to the 1/1 crystal and is in the third house second crystal in. So TGC can be seen in house 3 starting at the fourth line in. Then from that point the record plays, so starting in the third house for my music is like having Gemini on the AC or first house cusp. Take a look at your own crystal, see what position you start in and where that puts the other Hexagrams or DNA codons when it comes to your own chart. I hope we are playing beautiful music together. You can also find our the notes on a keyboard that are relevant to the letters of DNA and literally play your whole record. So many layers of me. x
Tuesday, 18 March 2014
Map 866 I've got my Mind Set on You
Napoleon Hill continued writing because he felt people wanted to hear from him. That’s as good a reason as you can get for writing, somebody wants to read what you have written. When writing imagination is your best tool or at least second to your pen. So what do you want to write about, decide in your mind what that is to be and confirm that you have a strong desire to do this. Your motivation and desire are both strong. Don’t write the same as everyone else has written, resist what is familiar and seek out the opportunity to write about something important to you and different. Think about it, plan it out and act upon it. Energy in the form of molecules in a constant state of flux are always available ready to journey to wherever they are needed. Whatever you think about you also attract towards you. No wonder people who right books on horror often attract difficulties into their life when you read the subject matter of their books they must be attracting molecules of horror in their direction. Admittedly they are useful to their writing but not in their everyday lives. How do we separate them. Is light hovering somewhere like a wireless connection waiting to be drawn in the direction of somebody who is thinking like them. They can be with you in the blink of the eye like spooky action from a distance as they call it in science. You are now connected telepathically.
Your mind will also have an effect on the people you associate with and theirs with you. Your mind in a constant state of adaptation changing minute by minute as new ideas come toward you. If you think negatively you will bring that negative energy towards you too and the negativity will be aimed at you. e.g. He hates me because I hate myself. Your thoughts are a self fulfilling prophecy.
When your mind is in perfect balance and harmony and for so long as that harmony prevails add your mind to someone else's and between you a master mind of streaming energy is born. When two meet of like minds then a third energy arrives which connects us to a field of energy which we can also use. This source is invaluable for as long as harmony persists between the two. Can you imagine what useful energy could be acquired when all the minds are tuned to say acts of kindness and become like a super brain with access to the field of all possibilities. To be in the spirit of inspiration and working as a team there is little we could not achieve when we become as one mind.
This is why is is vital we are genuine and real in our kindness, we can observe others but not judge them because if we are ‘playing’ at kindness the Harmony aspect will disintegrate and the super brain disconnects. Don’t be like you think you should be, watch every single action you take, reread everything you write, in the hope of getting your message across but no alienating anyone on the way. That person may need help to see themselves rather than alienation.
A minimum of 2 people are required to form a master mind, just two people can call themselves a group. The groups power becomes immediately noticeable as they each stimulate positively the mind of the other increasing their vivid imaginations and connecting them to a 6th sense which will flash new ideas onto the group, whatever it is they needed or wish to discuss will pour out of you as though magnets where attracting those ideas to you personally. So imagine if a third person joined the group and so on how big can one brain get. Meeting together to discuss for example DNA will increase their chances of being more creative. Your biggest asset is your brain use it and share it with others. To work as a group as one mind is the key to success, as Watson and Crick have shown us, they discussed things about DNA all the time they shared all and everything with each other because they knew the success of one was also the success of the other there was no competitiveness ruining their thinking. In a group each participant knows their purpose and they work together, they brainstorm freely, think aloud with each other, a close knit group that creates a master mind Watson, Crick and The Field this is the power of a group that works in harmony with each other. It might also be said much as I hate to say it that had Rosalind Franklin had someone she could trust and brain storm with or had W & C been able to bring her into their master mind she may have gotten her message across sooner holding onto your information is not the best plan.
Inspiration taken from Napoleon Hill Magic Ladder of Success.
Your mind will also have an effect on the people you associate with and theirs with you. Your mind in a constant state of adaptation changing minute by minute as new ideas come toward you. If you think negatively you will bring that negative energy towards you too and the negativity will be aimed at you. e.g. He hates me because I hate myself. Your thoughts are a self fulfilling prophecy.
When your mind is in perfect balance and harmony and for so long as that harmony prevails add your mind to someone else's and between you a master mind of streaming energy is born. When two meet of like minds then a third energy arrives which connects us to a field of energy which we can also use. This source is invaluable for as long as harmony persists between the two. Can you imagine what useful energy could be acquired when all the minds are tuned to say acts of kindness and become like a super brain with access to the field of all possibilities. To be in the spirit of inspiration and working as a team there is little we could not achieve when we become as one mind.
This is why is is vital we are genuine and real in our kindness, we can observe others but not judge them because if we are ‘playing’ at kindness the Harmony aspect will disintegrate and the super brain disconnects. Don’t be like you think you should be, watch every single action you take, reread everything you write, in the hope of getting your message across but no alienating anyone on the way. That person may need help to see themselves rather than alienation.
A minimum of 2 people are required to form a master mind, just two people can call themselves a group. The groups power becomes immediately noticeable as they each stimulate positively the mind of the other increasing their vivid imaginations and connecting them to a 6th sense which will flash new ideas onto the group, whatever it is they needed or wish to discuss will pour out of you as though magnets where attracting those ideas to you personally. So imagine if a third person joined the group and so on how big can one brain get. Meeting together to discuss for example DNA will increase their chances of being more creative. Your biggest asset is your brain use it and share it with others. To work as a group as one mind is the key to success, as Watson and Crick have shown us, they discussed things about DNA all the time they shared all and everything with each other because they knew the success of one was also the success of the other there was no competitiveness ruining their thinking. In a group each participant knows their purpose and they work together, they brainstorm freely, think aloud with each other, a close knit group that creates a master mind Watson, Crick and The Field this is the power of a group that works in harmony with each other. It might also be said much as I hate to say it that had Rosalind Franklin had someone she could trust and brain storm with or had W & C been able to bring her into their master mind she may have gotten her message across sooner holding onto your information is not the best plan.
Inspiration taken from Napoleon Hill Magic Ladder of Success.
Wednesday, 12 March 2014
Map 865 Energy Movements and Directions in Nine Star Ki
Imagine
yourself at the centre of this pattern and energy lines are coming
outwards green to tree, yellow/orange to earth, red/silver to metal,
purple to fire, blue to water. Start at the centre with the yellow
dot of the position you find yourself to be standing in for your nine
star ki. My numbers are 1/7/8 which puts me standing in the North
East number 8 position facing South West. So when I am standing in
the North East facing South West I am looking in my Sheng Ki or best
direction towards the light of the South West Number 2 direction. The
lines coming out of this position moving into the light. This is the
time of day when the sun starts to move down again the best part of
the day is done and you can start to think about home and winding
down. Taking a stroll in the fields. A time for all things connected
to Mothers, Romance, etc., Banks, Land and Property all associated
with the S.W. Now it is wonderful to look to the light and the
positive in your life but if you don't turn around to see what shadow
is pursuing you from time to time then the darkness of your shadow
can consume you. Turn around and see what those challenges are. In
the image above we sit N.E. So when we turn around we are now facing
N.E. And the S.W is now behind us. The shadow and darkness are right
in front of you. Face the fear and do it anyway because avoiding it
wont make those shadows go away. Find out what your shadows are and
embrace them, making your weaknesses also your strengths. If you find
ways to present the parts of yourself in the darkness and bring them
into the light they will be dissolved rather than you being consumed
by the darkness. Make your shadow part of your creative spirit, make
something useful out of this energy. Hmmm I wonder if I am on the yellow brick road. x
Sunday, 9 March 2014
Map 864 64 Codons of DNA in a Hexagonal Pattern
This is a pattern of all 64 codons of DNA in their pairs 2 Hexagrams making one 6 piece pattern.
The can overlap and incorporated themselves into another pattern but the bottom line must be on the bottom of the pattern. Their are many ways to play this game and obviously many variations of how it will turn out. Start with GGG/CCC Hexagrams 1 and 2 and add from their wherever you can. Enjoy x
The can overlap and incorporated themselves into another pattern but the bottom line must be on the bottom of the pattern. Their are many ways to play this game and obviously many variations of how it will turn out. Start with GGG/CCC Hexagrams 1 and 2 and add from their wherever you can. Enjoy x
Friday, 7 March 2014
Map 863 Pictures framed from Moments in your life
If you imagine the scene....something you particularly want......say a white horse. Do we see the bigger picture, I am going to need a field, biggest picture, I am going to need a stable blue frame, I am going to need the money to finance this, the yellow frame and the main focus of it all is the white horse at the centre. Seeing the bigger picture might be useful but if you really want a horse you had better be focused on that Magenta frame at the centre.
The images give you an idea of forefronts of the mind are we moving into the image or out of it. A row of pictures on the wall in ever decreasing frames would tell the story very nicely. Focus and the horse is yours.
So we have four different sizes of an image, if we kit those picture frames out so they can be turned over and show another image at the back we have 8 ways of looking at something.
The frames are made up from the points on The I Ching that denote the Nine star ki movements. x
The images give you an idea of forefronts of the mind are we moving into the image or out of it. A row of pictures on the wall in ever decreasing frames would tell the story very nicely. Focus and the horse is yours.
So we have four different sizes of an image, if we kit those picture frames out so they can be turned over and show another image at the back we have 8 ways of looking at something.
The frames are made up from the points on The I Ching that denote the Nine star ki movements. x
Wednesday, 5 March 2014
Map 861 Ribbons of RNA
This is the string version
of I Ching RNA. Take 8 colours of ribbon and cut two of each colour
into the same length. Then as you can see from above you intertwine
the ribbons together one of each vertical and one of each horizontal
and you end up with the pattern above. It could not be simpler to
show the I Ching in colour.
How very different it
appears for RNA than it did in the earlier image for DNA.
Map 860 Ribbons of DNA - I Ching
This is the string version
of I Ching DNA. Take 8 colours of ribbon and cut two of each colour
into the same length. Then as you can see from above you intertwine
the ribbons together one of each vertical and one of each horizontal
and you end up with the pattern above. It could not be simpler to
show the I Ching in colour.
Map 859 Man v Machine
Man
v Machine
The
genes used to form the eyes are also used to form the temporal lobe.
Does this condition us only to see the world through our own levels
of feeling. Can we change that and grow.
Are
we data packed at birth and only interested in those desires that we
are conditioned to be interested in.
A
computer is a silicone data base, humans a carbon based data base.
As
humans we have knowledge of perhaps 100 years. The computer has all
the knowledge that it is programmed to know and then we plug in the
internet and it knows a whole lot more than we could possibly hope to
learn in 100 years.
We
function on feelings, silicone doesn't. The super conscious could be
a super computer. So man or the machine, one gives information
without emotion and the other emotes its information. Are we not as
human beings learning to be less emotional and more rational just
like a computer, or are we living, emotional, feeling beings for a
reason.
A
hacker can influence the computer, we as humans can be influenced by
our families, society or brainwashing. If our DNA is amended we cease
to be the unconditional bundle of love that life delivered. Will that
conditioning change us forever in ways we can only imagine.
Surely
we must find ways to give the world what we have to offer and do the
things that we are best designed to achieve unconditionally x
Map 858 Random Life Choices in DNA
From this small map all of life can be created:
We can recreate from the above and make whatsoever we choose by placing the triangles into random patterns like the map below of 36 triangles from which we can read in all directions every single one of the 64 codons of DNA.
So any string of DNA can be made from the triangles e.g., AGCTGCAAACCG
Would be Green, Yellow, Blue, Orange, Yellow, Blue, Green, Green, Green, Blue, Blue, Yellow
Could life be any simpler. x
We can recreate from the above and make whatsoever we choose by placing the triangles into random patterns like the map below of 36 triangles from which we can read in all directions every single one of the 64 codons of DNA.
Would be Green, Yellow, Blue, Orange, Yellow, Blue, Green, Green, Green, Blue, Blue, Yellow
Could life be any simpler. x
Monday, 3 March 2014
Map 857 March 2014 in Nine Star Ki
Aspects of Love
This is controlling,
destroying or adapting energy, all of which passes through the centre
of a chart.
Energy coming from the
inside. Inbetweeners energy. Short cuts.
This is supportive and/or
creative energy all of which goes around the outside of the chart.
Creative, supportive energy is moving clockwise receiving and adding
to the energy. Anticlockwise supportive energy is more giving and
taking away from the energy with its generosity. Charitable would be
a good word. Nothing is coming from inside. Going around the
outside, no short cuts through the centre.
So next time you need to
increase your wealth in order to spend it look to the aspect of this
current month of March 2014. We have 4/7 at the centre of the chart.
7 controls or destroys 4 so excessive spending this month will take
its toll on the growth of your wealth and prosperity. It is a cutting
through centre energy where Venus is spending and enjoying it and
Jupiter is not is a position to much expand on itself because it is
being drained. Having said that the joy of being in the 7 position
can make you feel exuberant and this in turn can lead to over
spending and exhaustion of your funds. Don't let others encourage you
in this over indulgence because life seems more fun, take a more
responsible view. If you don't use all your energy draining the
wealth and prosperity tree area you can use some to support the
career or water area which in turn will once again increase your
wealth and prosperity. So instead of settling on one line between 4
and 7 all inner workings you could incorporate some outer workings
too creating 1 water would certainly help wealth and prosperity and
avoid a total exhaustion of your funds.
Just think before you spend
and you can have fun spending but you don't need to totally exhaust
your funds you can add some and spend some. A single destructive line
can then be changed into a more dynamic triangular energy. Enjoy March, don't get to April and expect change because April will be less exuberant and more responsible but it is still in spend, spend, spend mode. Wear your thinking cap and enjoy x
Sunday, 2 March 2014
Map 856 Best directions for Nine Star Ki
The Directions of Nine Star Ki Energy
When
you look closely at the way energy moves it is something like an
arrow heading in various directions to meet it's match. James
Redfield talks of the belief in the arrow of time that shows the
world has purpose and direction. Leibniz talks of the art of
combinations, the unstable position of an arrow in flight is like the
right here right now. Entelechy is the motion that carries the arrow
forward to it's destination. I feel that is something like RNA. We
are born with our DNA but RNA helps us to make choices and
adaptations to that original map. So even when an arrow is in full
flight it can change direction and not until the arrow strikes can we
be sure of the end result. You have an idea it is strong enough to
attract the energy required to bring that idea to fruition but if you
start to waver, do I or don't I want this after all, that energy can
be diverted in the blink of an eye and never reach you.
So
if you are thinking, I need money to pay my bills, energy is
attracting towards you immediately, and then you think but I don't
have enough to meet my needs, in that moment the arrow is diverted
elsewhere and your bill left unpaid.
Changing
the way you see and think of money is the key. So many people think
money is something they can get so they can give it to someone else,
that reeks of guilt and anyway why doesn't the energy just divert and
cut out the middle man, you.!
Either
you want money or you don't, don't allow yourself to feel guilty
about wanting a comfortable life. If you have anything over you can
give it away but you wont attract money to you just to give it away.
You can have big plans that need big money and none of it is for you
but you need to see yourself playing a part in the receiving and
giving of these funds or it simple wont happen.
I
have told this story before but I love it so much it's worth
repeating.
The
Dalai Llama woke every morning and looked in admiration at his gold
watch. He adored it, its craftsmanship and beauty. Every day for some
months he did the same thing and then one day realised for all the
love he had given this watch he had never once received any love in
return. It is just a watch an inanimate object incapable of love and
he isn't. Lesson learned. Though I bet he still wears his watch but
with a better understanding of its true value as an object of beauty.
When
he had big plans for a charity venture he was talking all about what
he wanted to do and one of his chaps interrupted him to say, “that's
all well and good but where is the money going to come from for all
of this”. He replied, “from wherever it is now”. One negative
reaction and one positive reaction. The Dalai Llama knew without a
shadow of a doubt that if he was to build it the money would come
from somewhere and I have no doubt it did. The other chap has a more
negative, why would that happen to me attitude, which means that had
he been in charge of the funds for this project it would never have
gotten off the ground. Vision, that's all we need. That is why winter
is the season of visionaries because this is when you have time to
meditate on your plans for the spring. Bring your world to life with
big ideas. Life is a combination of energies, biology works in pairs,
your arrow is coming to me you and together you can make the world a
better place. Everything needs to be balanced and harmonious, not
excessive or greedy but one man's greed is another man's comfortable.
So do not judge others after all we may well all be were we put
ourselves.
Look for your own best direction....for me 1/7/8 one is my year number 7 my month number and if 7 is in the centre 1 is sitting in the 8 position. Therefore I am siting in the N.E. facing S.W. so all things associated with the South West are favorable to me and I should sit facing this direction wherever possible in the hope of catching as many of those arrows and I can.
Subscribe to:
Posts (Atom)
















