Map 868 DNA Saturnian style and Jupiterian Style in the Crystals

When we look at the X factor as its spread out across a page we see that it spreads out to produce the letters:

            GCGATACGC

Just nine letters which colour in the whole page as a yellow, blue, yellow, green, orange, green, blue, yellow and blue line. 9 Letters 9 vertical lines of colour. If we consider this line to be a reduced, limited or Saturnian line of DNA we can expand it as follows jupiterian style as follows:

    Saturn        GCGATACGC becomes… 

    Jupiter        GCGCGAGATATATACACGCGC

GCG = 1 codon then start at second letter and CGA can be created and so on until all 7 codons can be found that leaves 5 codons down one side of the crystal that do not appear.

GCT - CTA - TAT - ATG - TGC do not appear and yet as we can see above they are in there. So the crystal can be expanded to show 7 codons starting at the bottom GCG and ending at the top of the crystal at CGC. Perhaps this is showing only one side of the crystal.

So the crystal would appear as a stack of bricks with blue and yellow running through the centre of them with orange and green on the outside. Very different indeed.