There are five
different crystals of DNA 3 with 12 codons, 1 with 4 codons and a
double crystal with 24 codons. This image shows us the single cube
and the double floating about in the air full of potential for life.
Genetic information stored inside them, desires waiting to be born.
Your own codon belongs to one of these crystals.......mine 1/7 TGC
belongs to the 1/1 – 9/9 Fire and Water peaked crystal. So my
particular crystal has a desire to be a certain way and attract into
my life the lessons I need to learn and the messages I wish to
deliver. Notice the matrix running through them and when the time is
right the opportunity presents itself. Make sure you are ready for
all that life will throw at you and that you can say I made a
difference in this world. Just being here means you make a difference
but to be a major player like Stephen Hawking............. However
difficult life may seem there is always something you can do and
succeed at........Steve Jobs....... everything around you that you
call life was made by people who are no smarter than you........and
it is not even necessary to be called Steve. Live that life the
precious gift you have been given to the best of your ability.
A look at Astrology, Feng Shui, Nine star Ki, I Ching and then finally on to DNA. A look at all of these principles through patterns. These are my thoughts and I can give you no evidence but ask that you accept what you are comfortable with and disregard the rest.
Friday 27 February 2015
Friday 20 February 2015
DNA Codons in Triangular Form in The Universe
Image this energy swirling above the Universe constantly seeking out its matching partner for creation............what a wondeful colourful life we all lead. x
Its is tiny and invisible to the eye but its there. x
Monday 16 February 2015
The Ho Tu I Ching Map and its planetary positions
This is a map of The I Ching Diagonally from the top 2/2 corner to the bottom 6/6 corner showing the planetary combinations with the map. This is the Ho Tu or The Word DNA map based on the numbers 28143976........
Another variation on the same theme is a diagonal map of The I Ching in numbers only...
Sometimes its easier to see patterns within small or larger images.
If you fold it over at the middle point you will see it still forms
patterns of sorts that can guide you.
Sunday 15 February 2015
DNA Triangles
Life in action x
Nine Star Ki with 9 at Centre
The
above Bagua is based on the number 9 at the centre
3
– 6 – 9 alternate across the diagonal line from North East
to
South West. No matter how big the bagua becomes 3 – 6 – 9
will
be the only numbers that appear in that diagonal. As you
can
see the 9 Purple pieces create a pattern of their own so when
you
make up a map you can check you have them right if the nine
parts
pattern is the same as the centre number and the diagonal line
will
always be either 1 – 4 – 7 ….. 2 – 5 – 8 ….. or 3 – 6 –
9 again
dependant
upon the centre number. A quick glance of correction.
You
can make up all six sides of the bagua and if you remove the
number
at the centre and all of its parts..... there will be nine gaps
in
each map..... a water feature with the water pouring out of the
gaps
would be beautiful. No matter what number is at the centre
the
same waterfall would occur............so much difference and yet
they
have so much in common.
Should
you wish to create your own jigsaw you can choose from
nine
of the above colours and numbers to make up the 81 piece
jigsaw.
Aspects in the Patterns of DNA Codons
Aspects
of Love
All
aspects whether easy or difficult are created by love.......love is
everything and that means good or bad. So if some aspects are easier
to cope with than others it may mean your life is blissfully easy and
you achieve very little. Or if they are more difficult to get a
handle on it could be the makings of you. No aspect pattern in my
opinion is any better than another, only different. You may have
certain energies that need to be released and this is your
inheritance to release them in the way of the aspect pattern you are
born to. Embrace that aspect whatever it may be.
Lots
of red in your aspect shape and you are born to act be decisive....
hardworking, actions speak louder than words, you can get things
done. If a job is worth doing its worth doing well and if you need
something done ask a busy person, thats you. Make time for yourself
too. A little green and blue will help you to work, rest and play.
More
blue and you are talented, gifted and a little bit too laid back
sometimes, you could take your talent for granted or let it go by
unnoticed because your too busy on the mundane things of life like
making a living. Wealth would be an advantage here so that work does
not get in the way of your talent. Alternatively if you can work at
your hobby and make a living can it really be considered work. Add a
little green and red and you can get your creativity out there.
Green......contemplation
on a theme.........then you realise the variations on that
theme......before you know the day has passed you by......thinking,
pondering and hopefully realising all belong to the green energy. You
can absorb information like a sponge, stopping and doing something
with it is the key, constant learning can be a pleasure but it can
also be pulled together, a little bit of information here added to a
little piece of information there and you have something new. Add a
little blue to the mix and you have a talent for discovering
something new.........add a little red and you might be able to do
something with it.
Red,
Green and blue and you have the ability to think it through, act on
it and manifest it. So if you have The Worker aspect all red, you are
going to be busy always doing something, even if its only
pottering.......try to make time for rest and play. For example
reading could bring in a bit of green energy whilst still keeping you
busy.........crafting or gardening could bring in a bit of blue
whilst once again keeping you busy. Attract the colours you need in
whatever ways you can think of.
All
blue you are creative, if you create a garden there will be little
chance of you being able to maintain the beauty of your artwork
without putting in the effort to work on it hence you can bring in a
little red energy. Maybe redesigning could give you a little green.
Finding the ways to use everything you have brought with you into
this life, your inheritance wants to be delivered and you should do
all in your power to see it through.
Lots
of green full of ideas but the splash of red will keep you busy
bringing those thoughts to life, add a flurry of blue and you can
manifest them too.
Whatever
colours dominate for you the lack will be attracted to you and the
excess has the potential to overwhelm........find balance in all
things and enjoy every minute you have here on planet Earth.
The
Trine... 120* x 120* x 120* is a equilateral three sided
triangle thus it creates aspect lines in the same element. The
Triangle could be Fire, Water, Air or Earth focussed. In a birth
chart it creates a 360* full aspect and in The I Ching the four
corners of The Ho Tu or The Word contain all four elements trines.
The grand trine........eeeh life's Grand.........and it is because
your a very talented person born with skills you need to use rather
than improve on. If you are too easy going you may miss opportunities
because you don't realise just how talented or skilled you are and
take it for granted. You really do have a talent use it.
Blue
energy is considered fixed so again that doesn't make you as flexible
as you could be......or as outgoing as you could be. Peaceful, calm,
laid back is all well and good but talent left to go latent is such a
waste. Make sure that your inheritance and talent is given out to the
world.........deliver what you came here to bring.
There
are four examples of The Grand Trine...
CCC 2/2 Proline
TTT 2/6 Phenylalanine
AAA 6/2 Lysine
GGG 6/6 Glycine
Placed
at all four corners of The I Ching
The
Alternator...180* x 120* x 60 is
a triangle of red, blue and blue energy so this aspect will alternate
between being laid back and being busy. Work, play, work, play, with
no rest in between. You have to be careful you don't overdo it and
then need play time to recoup your energy. Exhaustion is a
possibility. The outlet for fun and play is where the two blue lines
meet and the hard work will be connected to the houses and signs that
the opposition line crosses. The red line is an opposing line but if
they can meet each other half way there can be balance and harmony
and the hard work will be something you enjoy doing even if at times
it can be exhausting and you can fall away into the blue aspect point
whenever it gets too much. Activity keeps your engine running too
much play can also leave you drained. If you allow yourself to get
too laid back you may not be able to motivate yourself again. So
balance in work and play is required.
There
are twelve examples of The Alternator...
TTG 8/6 Leucine
TGT 1/6 Cysteine
TGG 4/6 Tryptophan
GTT 3/6 Valine
GTG 9/6
Valine
ACC 3/2 Threonine
ACA 9/2 Threonine
AAC 7/2 Asparagine
CAC 1/2 Histidine
CAA 4/2 Glutamine
CCA 8/2 Proline
CCA 8/2 Proline
Note
how all of them appear to the outer Vertical edges of The I Ching.
The
Worker...180* x 90* x 90*......Also known as the T square
….busy, busy, busy. You are a hard worker there can be no doubt of
that, if a job needs to be done you will make sure that it is. There
is a lot of active energy here and finding time for rest and play can
be difficult. Think workaholic. There is the potential here for
overactivity symptoms....because you don't make time to relax. If you
can find a hobby you love that you can make a living out of then you
are in seventh Heaven, doing what you love and making a living from
it. The house or sign where the two 90* aspects meet could be an
outlet for these energies. You may be required to do physical work
but if it is more mental work then join a gym or take up a sport to
release some of the energy here. A build up of unused energy could
prove explosive. Cardinal highly motivated energy must get something
done.
There
are seven examples of The Worker in DNA codons:
TGA 4/7 Alert Stop
Opal
TCA 8/3 Alert Serine
ATG 9/4 MET/
start point
ACG 9/8 Threonine
CGA 4/1 Arganine
GAC 7/3 Aspartic
Acid
GAT 7/9 Aspartic Acid
GAT 7/9 Aspartic Acid
Two
alerts which mean they don't conform to the standard the way other
codons do......one Stop point and one Start Point and two others that
have conform to the usual standards. Otherwise nothing outstanding
about the position of them in The I Ching.
The
Ruminator...180* x 150* x
30*.....red, green and green energies. A lot of thinking and action
here. Stress and anxiety could result and energy is best released at
the point where the two green lines meet. The house and sign will
give you an idea of how best to utilise them. Ruminator's work on a
high level of focus......Sherlock Holmes would be a good
example.....he will focus on a problem until he resolves it.
Scientists will look at the same problem for years and keep going
back to it until it is resolved and often times when they do they can
bring something new into the world. Creativity and originality are
commonplace with this aspect, intelligent energy being used in an
intelligent way. Whatever it is they focus on it will take them on a
journey along the way they will absorb a bit of information here and
another bit there and collectively they can fit together and become
more than the sum of their parts. The journey can take you to the
edge of The Field and if you just push back the envelope that little
bit further you could well find the Holy Grail. Something that is
already out there just waiting for us to re-discover it. The Holy
Grail is something that exists but is hidden and The Ruminator is
well fixed to find it. That focus held for so long will prove
worthwhile in the end and something new and amazing could be
discovered.
There
are six examples of The Ruminator in DNA Codons...
CTG 8/4 Leucine
CTA 8/1 Leucine
TAC 1/3 Tyrosine
TGC 1/7 Cysteine
ACT 3/8 Threonine Alert
GCT 3/9 Alanine
GCT 3/9 Alanine
Just
one alert amongst them. No particular positions in The I Ching.
The
Magician...150* x 150* x 60*...
also known as The Yod or Finger of God. Fate plays a hand here. I
think it looks like a projector showing you the way of the world
based on what you project onto it. Until ego is under control you
could cause mayhem or things will feel stirred up and uncomfortable.
Creative imagination is at work here so would be useful for an actor
to project his memories into a role to bring it to life, this is
called Method Acting. If you have a memory of just the feelings you
need to bring to a role you can project them into the part you are
now playing. The two green lines meet and form the all seeing eye
giving flashes of inspiration. The power of creative visualisation
must surely be strong here. Maybe blue and green energy needs a
little bit of tornado to stir it up every so often or it may be happy
to sit and watch the projector playing out the film rather than
making things happen the way you want them to. Now thats magic.
Alternatively every time you dig up a past memory and relive it you
are potentially experiencing those feelings in your body all over
again. If The Magician can create on screen the life they want for
themselves then they should choose the roles that make them happiest.
There
are six examples of The Magician in DNA Codons...
TAG 4/9 Stop
Amber
CAG 4/8 Glutamine
GTA 9/7 Valine
GCA 9/3 Alanine
AGC 7/1 Serine
AGT 7/4 Serine
Alert
Just
one alert here and no particular position in The I Ching.
The
Lecturer...90*
x 150* x 120... red, green and blue.......work, rest and play. A
balanced energy. Think it, act on it, manifest it. This aspect is
bigger than the Teacher and thus it is called The Lecturer. Big life
lessons to learn and much to teach others as you pass it on.
Sometimes it will feel as though the same lesson comes up for you
over and over again and yet you feel you have learned from past
mistakes.....so why are you still making them. Until you learn how to
cope with whatever it is life throws at you you will be forced to
repeat the lesson. There is a karmic feel to the lesson.......you
have been here before and didn't manage to work it out. Do so now and
pass on the knowledge that you learn.
The
house and sign associated the the three points will give you some
clues as to the probable areas. There is much to be gained here when
you have an understanding of how the energy works for you. You can
can think it, feel it and manifest it with these energies.
There
are seventeen examples of The Lecturer in DNA Codons...
TTA 8/7 Leucine
CCG 8/8 Proline Alert
CGC 1/1 Arginine
TAT 1/9 Tyrosine
TAA 4/3 Stop
Ochre
CGG 4/4 Arganine
Alert
ATT 3/4 Isoleucine
GCC 9/9 Alanine
ATT 9/1 Isoleucine
GGC 7/7 Glycine
GGA 6/7 Arginine
GAG 6/9 Glutamic
Acid
GAA 6/3 Glutamic
Acid
AGG 6/4 Arganine
AGA 6/1 Arganine
AAG 6/8 Lysine
In
no particular order in The I Ching. Two of them marked as alerts.
The
Teacher …
90 * x 150* x 60*...You love to learn purely for the sake of it. You
love to pass on what you have learned too. Red, green and blue again
but without the karmic connection...you know how to work, rest and
play. Your gains may not be as huge as the Lecturer but you will gain
so much from the proper use of these energies. Learning from the
Teacher is easy and you can then go into further education if you
choose.......everyone you teach something improves there lives and
that in turn improves yours. Your a natural born teacher with a lot
to offer.
There
are five examples of The Teacher in DNA Codons.
TCG 8/9 Serine
CAT 1/8 Histidine
CGT 1/4 Arganine
GTC 3/7 Valine
ATC 3/1 Isoleucine
In
no particular position in The I Ching.
The
Thinker...150* x 120* x
30*...green, blue, green, very laid back thinker here. Similar to the
Ruminator but without the red energy that can make sure you get that
information out there. Don't spend so much time in quiet
contemplation that you forget to let the world know what you have
discovered along the way. Perfect if you live in a Monastery......or
have a Professorship at a University that pays you to think.......for
most of us it could become idling away the hours, creating nothing
bad in the world but the world could be a better placed if it could
get its hands on your ideas. You absorb a lot but don't necessarily
put it back out again. The Point where the two green lines meet could
be the best way for you to put the information you have absorbed back
out into the world. It would be a shame to waste such pure thought.
Thoughts are alive too and are attracted to your ability to think so
deeply but they also want to be born, don't let them down.
There
are six examples of The Thinker in DNA Codons...
CCT 2/8 Proline
CTC 2/1 Leucine
CTT 2/4 Leucine
TCC 2/3 Serine
TCT 2/9 Serine
TTC 2/7 Phenylaline
All
positioned on the top horizontal line of The I Ching.
So
there we have it just eight shapes of DNA or aspect. The Trine, The
Alternator, The Worker, The Ruminator, The Magician, The Lecturer,
The Teacher and the Thinker.
Astrology
charts are in twelve sections starting with the 1st house
through to the 12th house. The DNA codons are made up from
the date of birth of the person which can be found in the maps marked
Nine star Ki Numbers for the year number and then move to Nine Star
Ki month Numbers for the second number.
My
birthdate is 15th March 1954 so I look to the year chart
and find that year in column 1.......then in the month chart I find
the number 1 across the top move to the month of March and find the
number 7 here and the DNA Codon letters TGC.
First
|
Second
|
Third
|
|
T
|
Aries
|
Leo
|
Sagittarius
|
A
|
Taurus
|
Virgo
|
Capricorn
|
G
|
Gemini
|
Libra
|
Aquarius
|
C
|
Cancer
|
Scorpio
|
Pisces
|
Codons
are made up of three letters, my own being TGC gives first T Aries –
Second G Libra – Third C Pisces – thus creating a Ruminator's
aspect from the 1st to the 7th to the 12th
house and then back to the 1st house. 180* x 150* x 30*
So
this aspect is about relationships between you and I the 1/7
houses.....then on to the hidden enemies and deeply spiritual nature
of the 12th house. Much to Ruminate on here. Read up on
Aries – Libra and Pisces and fit what you find to the potential
available in this aspect pattern. The outlet is in the 12th
house …. I believe.....deep sensitivity... dreamy....empathic and
artistic. So I am (Aries) I balance (Libra) and I believe (Pisces). I
think I will take from that I believe I am balanced. At least in
these later years......or perhaps I balance what I am with what I believe.
Randomly
I choose TTG which is Aries – Leo – Aquarius...... 1st
- 5th and 11th houses.....120* x 180* x 60*
This forms the Alternator aspect. The outlet for this codon is the
1st house. 1st I am an entrepreneur passionate
about my interest … I will succeed, be proud and talented...I
know....I am open to making discoveries in unusual ways...very
unconventional. I am (Aries) I will (Leo) and I know
(Aquarius).........I know I am, I know I will...........
CGA
– Cancer 4th house – Libra 7th house –
Capricorn 10th....The Worker aspect.......the outlet for
the aspect can be found in the 7th house of Libra. Balance
in all things. Cancer I feel – security needs – psychic.....Libra
I balance … sees both sides can be gullible but fair...Capricorn I
use...serious minded... hard working.....traditional...... I feel
(Cancer) I balance (Libra) I Use (Capricorn).........If I remain
balance I feel I can use all the tools at my disposal.
All
Codons can be detailed much further this way.
Saturday 14 February 2015
Answer to Quiz Question
I
am the light
Artistic
Synaesthesia
Heaven
and Earths
Hearts
Desire
Well done if you worked it out. x
Each DNA codon is an Amino Acid and each amino acids is also represented by a letter and each letter combines to make a new word. Simple. x
Each DNA codon is an Amino Acid and each amino acids is also represented by a letter and each letter combines to make a new word. Simple. x
Convert the DNA Code
A
quiz for the half term can you convert this DNA sequence into
something other than Amino Acids.
ATC
GCCATG ACCCACGAA CTCATCGGCCACACC
GCCCGCACCATCTCCACCATCTGC
TCCTACAACGCCGAATCCACCCACGAATCCATCGCC
CACGAAGCCGTCGAAAAC
GCCAACGAT
GAAGCCCGCACCCACTCC
CACGAAGCCCGCACCTCC
GATGAATCCATCCGCGAA
The
Answer to the code will be found on the next post. Enjoy x
The I Ching - DNA Codons and Crystals - 1/1 - 9/9 Fire and Water as Jewellery
Creating Jewellery from the world of DNA Codons and Crystals
1/1 –
9/9 Crystal
TGC – GCG – CGA –
GAT – ATA – TAC – ACG – CGC – GCT – CTA – TAT – ATG
DNA Codon
TGC
The 12
codons above are the codons of the 1/1 – 9/9 Crystal
36 Letters
in all in order to reduce the above in true Saturn style
note how
you can still create the same codons if you remove the repeating
letters
within the codons.
For
example TGC – GCG – CGA
can be
reduced to TGC – G – A so instead of
9 letters
we have only 5 to complete the whole sequence we end
up with
only 12 and not 36 letters.
Even as we
read the reduced letters they still make codons
that can
be found in the 1/1 – 9/9 Crystal
TGC –
GAT – ACG – CTA – TAT
then we
have TG to start over at the beginning again.
So
Saturnian style we can reduce the crystal by two thirds
we have
only 12 letters now not 36
As a
bracelet it becomes a strap of just 12 gems but
it can
display all 36 by stretching it our again
in a
Jupiter manner.
So you can
make a necklace with all 36 parts of the 1/1 – 9/9 Crystal in
full and
natural size and then make a reduced size bracelet of only
12
parts............as there are 12 codons in this crystal it could be
used
for any of
the 12 Hexagrams or Codons that they create. There are
3 x 12
codon crystals (36) 1 double crystal (24) and 1 small diamond
shaped
crystal (4) making a total of 64 Codons altogether which can
be
represented by just 5 crystal combinations.
If we add
gold links between the gems to create the size of bracelet required
the
beginning and the end of this row would be linked up into a circular
bracelet
shape. You could add a vertical row of three letters to denote your
own codon
in my case
TGC. Earrings could be just as the vertical portion and a necklace
could
also add
the vertical portion or create a cross shape from the three letter
codon that is you.
The
potential for 5 different parts of jewellery.
Friday 13 February 2015
Variations on the theme of the 1/1 - 9/9 Crystal
Variations
on A theme of the 1/1 Crystal
The
loose crystals above are waiting to be brought together ….. the
left hand side is Hexagonal shapes on top of each other creating a
barley twist effect.....
then
I have pulled them a little closer together in the centre.....and
finally a tight fit makes for a smaller set of codons so they seem as
light as air in comparison so I have added a ribbon to make them look
like balloons.........x
Information card for the Codon TGC in the I Ching
A closer look at things that might give us an insight into a particular codon. This one is TGC.....
imagine it as a playing card with information on each side.
More information can give you opportunities to check other areas...............discover yourself. x
imagine it as a playing card with information on each side.
More information can give you opportunities to check other areas...............discover yourself. x
Thursday 12 February 2015
The Ruminator - The Holy Grail
The
Holy Grail – The Ruminator
We
are on a quest to find the Holy Grail...........a quest in our case
can become a question....we do not need to leave our armchairs to
seek out the Holy Grail. For me the Holy Grail is Astrology, Feng
Shui, The I Ching and DNA. Many have searched and concluded The Holy
Grail to be a beautiful golden cup studded in gems, perfect for wine,
yet still it has never been found. What if the Holy Grail is
something completely different. There is an aspect in astrology I
call The Ruminator an aspect of 180* x 150* x 30* from any starting
point. It has two green aspects, so much thinking will go on here and
one red aspect giving you the energy to see it through.......no blue
energy though and that is the nature of the Ruminator.......they
focus on something to the exclusion of all else until a discovery is
made. Sherlock Holmes is a Ruminator once on the track of something
he would not let go until he solved the riddle. If it takes a
lifetime a ruminator will think on that same subject for as long as
it takes.
Let
us look at some of the people who have discovered Holy Grails.....
Albert
Einstein, Nikola Tesla, Michael Faraday, Alfred Nobel, Alan Turin,
Stephen Hawking to name but a few............
Fusion
could be said to be created at the point where the two green lines
meet releasing a volatile explosive energy, something new and
original can be created from this energy. You have pushed back the
envelope.......gone to the edge and just pushed those boundaries a
little further stepping into The Field and discovering something
hidden, just ripe for the picking. You can make discoveries never
before seen on Earth. They were there, hidden and ready for discovery
when the time was right and when the Ruminator has ruminated long
enough. The Holy Grail is not likely to be something discovered
overnight you have to put in the hard graft before hand and you have
to love what your doing so much that its no hardship to spend every
waking hour thinking about it. You have to believe in your own
ability and absorb information as it comes to you, on its own the
information may mean very little but over a period of time a little
bit of this added to a little bit of that makes the whole thing come
together. For me I know the information is right if it conforms to a
pattern... if it doesn't conform I call it an alert........don't
throw away previous thinking but find ways to adapt the alert to fit.
So if you have something you find interesting let it absorb you and
you it and one day another Holy Grail will be born which could change
life for mankind well into the future when that Grail is born. x
The
Ruminator in the TGC position.
For
me the Ruminator is a very good description of TGC T is in the 1st
House of Aries the house of the pioneer.............G is in the 7th
house of relationships and Libra............and C is in the 12th
house of Hidden things and Pisces.
I
am never happier than when I have something new to think about and if
I think on it for months and then find it to be nonsense I have still
enjoyed the journey. For me the Ruminator may be about matching up
the you and I.....making pairs and adding information to the thought
processes which take me into the hidden depths of Piscean oceans.
Whatever I come up with the energy will be created in the 12th
house of Pisces and I will need to take it shape it and create a new
form for that new idea.
Wednesday 4 February 2015
Nine Star Ki Cube
Perspective
is amazing each of these triangles is the same size just seen
from
a different angle.
Each
connection comes from The North to the South to the West
showing
us that North is South and East is West again dependant
upon
the angle of my perspective. The Inner workings of Nine
Star
Ki is dynamic and triangular in shape (red) whereas the four
corners
create the X Factor Cross (green)
Thinking inside the box with Nine Star Ki.
Sunday 1 February 2015
All 6 Crystal of the 64 codons of DNA combined
6/6 – 2/2 1/1 - 9/9 Double 8/4 – 7/3 Diamond
Firstly let us look at
the orderly way the 6/6 – 2/2 crystal is presented in such an
orderly fashion. The 6/6 contains no 1's or 9's and and is all about
Heaven and Earth. The 1/1 – 9/9 crystal is associated with the 6/6
– 2/2 crystal because it contains no 6's or 2's. Associated by the
lack in each other. The 1/1 – 9/9 crystal is more randomly placed
in appearance. Both are vertical by nature and if they had to find
someone to pair up with they would choose each other.
The Double crystal is
horizontal by nature and they connect together in so many ways but
the Hexagram numbers make it impossible to consider them separately.
They are a pair at all times. A relatively orderly pattern exists.
The 8/4 – 7/3 Crystal
is vertical and it pairs up with the smaller diamond crystal which is
centred so is neither vertical not horizontal. The strong connection
to the numbers 3, 4, 7 and 8 make these two wish to pair up.
Together they form all
64 Codons of DNA............64 Hexagrams........and all versions of
the combinations of the letters T G A C.
The six crystals also
fit well within the pattern of the diamond crystal at the centre
surrounded by its pairing the 8/4 crystal........then comes the
double crystal...........then the near outer is the 1/1 crystal and
the very outer reaches of the chart is the 6/6 crystal...........the
Heavens. The record of life shows this nicely. Life has a record of
everything that ever was and will ever be..............lets make
beautiful music together.
Double Crystal in a Jigsaw Pattern Bracelet
Whilst the double crystal makes two separate 12 codon bracelets it is noticeable that they are inseparable when we tie in the Hexagram numbers........the double crystal also appears to be horizontal rather than vertical as the others are. So I would keep these two parts together like
twin peaks of a church. It makes for a more expensive bracelet with 24 codons to present but
maybe the Double crystal can afford it.
twin peaks of a church. It makes for a more expensive bracelet with 24 codons to present but
maybe the Double crystal can afford it.
Diamond Crystal in a Jigsaw Pattern Bracelet
This is a Jigsaw Bracelet made up in the pattern of the Diamond Crystal but this has only 3 parts each of T G A and C. Note that with this crystal there are only 12 parts not the usual 36 parts now this bracelet could be made in many ways as it is with just the 12 parts or we could repeat the 12 parts 3 times to create a 36 piece bracelet. I prefer to make it 12 pieces but bigger than the previous jigsaw parts.............each can contain one full month of time instead of three parts per month of the other crystals. There is no doubt about it the diamond crystal contains only 4 codons so I see no reason to make it into 12.
8/4 - 7/3 Crystal In a Jigsaw Bracelet pattern
This is a Jigsaw Bracelet made up in the pattern of the 8/4 - 7/3 Crystal 36 parts 9 of each T G A and C. Note how precarious life can be. There is more randomness to this bracelet than there is to the 6/6 bracelet.
6/6 - 2/2 Crystal in a Jigsaw Pattern Bracelet
This is a Jigsaw Bracelet made up in the pattern of the 6/6 - 2/2 Crystal 36 parts 9 of each T G A and C. Note how precarious life can be. Note how much more orderly the 6/6 crystal patterns are compared with the 1/1 Crystal.
Subscribe to:
Posts (Atom)