This is an image of all six crystals made into circles to form the circle of life. All life itself can be made from the patterns in this circle.
The Outer edge is Heavenly crystal 6/6 - 2/2 second one in is the 1/1 - 9/9 crystal. This is followed by the double crystal and then the 8/4 crystal is closest to the centre piece which is made from the smaller crystal of the Diamond which has only four codons.
Life is more simple than we think x
A look at Astrology, Feng Shui, Nine star Ki, I Ching and then finally on to DNA. A look at all of these principles through patterns. These are my thoughts and I can give you no evidence but ask that you accept what you are comfortable with and disregard the rest.
Sunday, 29 June 2014
Thursday, 26 June 2014
Map 920 Abstract Positives and Negatives in The I Ching Hexagrams
Map
of Positive and Negative Hexagrams
The
green cube is a negative that is hemmed in by positives and has no
way to connect other than to a positive. All others can connect to
their own kind. Can we reach from a positive to a negative and get
around the whole board. Start at any position and mark off neg and
pos as you go the plan is to mark off all 64 codons. Good Luck.
Well
I certainly didn't manage it, will you. Beginning and end marked with
a heart. x
Map 919 World Cup Finals as a String of DNA
World
Cup DNA
Lets
take the dates of the World Cup Finals, change them into Nine Star Ki
Numbers, then change them into DNA letters, just what kind of
string of DNA would be produced as a representative of the World Cup
Finals and what could we make from them.?
1930 7/3 1966 7/3 2002 7/4
1934 3/1 1970 3/1 2006 3/9
1938 8/7 1974 8/6 2010 8/6
1942 Wartime 1978 4/4 2014 4/3
1946 Wartime 1982 9/9
1950
(2) 5/6 1986 (2) 5/7
1954 1/3 1990 1/3
1958 6/1 1994 6/9
1962 2/7 1998 2/6
Sometimes
the Final is played in June and sometimes in July hence the
variations on the theme. Number 5 is represented as male, I don't
think anyone will quibble with football being more masculine than
feminine.
Then we have the two dates in 1942/6 that are missing for wartime, do we
leave them out altogether because those games are not a part of the
DNA of World Cup Finals. I would say yes. Potentially you could add
two STOP markers, or even 1/1 water plus water as the lightest of
coverings or even a portal. Last but not least you could put in the
DNA markers for 4/4 and 9/9 as they would have been the dates they
were played. As this is a map of actual world cup finals for me I
would leave them out all together. There are no gaps in DNA, as far as we know.
So
what do we get as a string of DNA to describe the World Cup Finals.
GACATCTTATTTTACAGATACAGATTCGACATCTTGCGGGCGTTCTACGAGTTTAGTGCTTTGTAA
So what could we make from this DNA. Enjoy the world cup
wherever you are in the world and know that we are all a part of the
whole. X
Wednesday, 25 June 2014
Map 918 Another look at the directions of the Crystals Variations
There is no doubt about it the simplest of the crystals is the 6/6 Crystal and then the 1/1 Crystal
6/6
Crystal – Read left to right CCC, CCT, CTT, TTT
Read
right to left TTG, TGG, GGG, GGA, GAA
Read
left to right AAA, AAC, ACC
read
from right to left TAC, ACG, CGC, GCT, CTA,
read
left to right TAT, ATG, TGC
8/4
Crystal read from left to right GAC, ACA, CAC, ACT, CTC,
read
from right to left TCT, CTG,TGT, GTG, TGA,
read
from left to right GAG, AGA
A change of angle for the 8/4
Small
3 codon Diamond Crystal read left to right CAG, AGT, GTC, TCA
Double
Crystal - 24 Codons read left to right TCC, ATC, AAT, CAA, GCA, GGC,
read right to left CGG, TCG, TTC, ATT, CAT, CCA, GCC, AGC,
AAG, TAA,
GTA GGT, AGG, TAG, TTA, GTT, CGT, CCG
Its clearly more difficult for the double crystal to change direction because of its size.
Ending
on CCG would be ready to start off again reading right to left TCC.
Clearly there may well be more ways to tie them together direction wise but this batch I would say are the best of the bunch. The direction DNA takes has to be a vital part of what it creates. x
Tuesday, 24 June 2014
Map 916 36 Triangles of DNA to make a Life
DNA
Map of Life
From
just 36 triangles all 64 codons of DNA can be read. In this
particular combination there are 9 Fire, 9 Earth, 10 Tree/Air and 8
Water. A perfect balance would be 9 of each but nevertheless this map
with its excess of Tree/Air would be able to create everything in
life. Could it be that we are
all
of us born with our own 36 triangles and some have an excess of one
or two elements and they tend to bring more of that life experience
to the world. For example this could be someone in the media using
Tree/Air energy to communicate verbally, a reporter or writer for
example. Someone with an excess in water could be more spiritual
etc., So maybe those with 9 of each element are the most balanced and
harmonious of us. Lack of judgement of others would be required if we
could prove we were just being what we have been given as tools x
Monday, 23 June 2014
Map 915 Four cubes to Make The World
1 2 3 4
It takes just four cubes to create all 64 Codons or twin Hexagram cubes of DNA.
The Larger cube shows one side of the cube the smaller cubes shows its opposite side.
So to the left we have cube 1 CCC and GGG using this cube alone and using The Ho Tu or The Word Map of The I Ching which is positioned at 28143976 all of the diagonal hexagrams (8) from top left to bottom right of the map are made from this cube.
The cube to the far right AAA and TTT can make all the codons of DNA(8) from the top right to the bottom left of the map. With these two cubes alone we have created an X across the map making 16 codons.
The second cube to the left above shows CAA below and GTT above and from this cube 24 codons 8 in the Fire quadrant, 4 in the Water quadrant, 4 in Tree/Air and 8 in the Earth quadrant.
The second cube from the right above shows AGG below and TCC above and from this cube 24 codons 4 in the Fire quadrant, 8 in the Water quadrant, 8 in the Tree/air quadrant and 4 in the Earth quadrant.
The mix of the four cubes shows this pattern below. Again they conform to pattern.
We can see cube one creates a diagonal line top left CCC Earth to bottom right GGG Heaven.
Cube two creates a pattern that is very strong in Fire and Earth.
Cube three creates a pattern that is very strong in Water and Tree/Air.
Cube four creates a diagonal line top right TTT (Earth and Heaven combination) to bottom left AAA (Heaven and Earth combination).
So all four cubes are about making patterns of Heaven and Earth in varying degrees.
Excuse the clarity of the colours in the cubes above as they are casting shadows and making the colours look different. The colours as are stated in the letters. I have added below the colours opened out as I do not know how to type it as a cube with colours.
Anyone for Ludo?
Map 914 S String of God like Dominoes or A String of DNA
Domino another word for God............another way of expressing DNA codons.
AGACACCCCCTTTAAGCCGTTGGG
How many ways to say I love you x
Map 913 The Cube of DNA and its matching Cube
This
is a set of all 64 codons in Hexagram order each pair of hexagrams
makes a cube GGG can be seen above and its shadow or rear view is
three blue sides for CCC all pairs of hexagrams make up a cube but
they also have a matching pair which create the other cube by
flipping the original over from left to right and then top to bottom.
So only 40 codes are required.
List of Codons and their matching partner, some have no match, some have a matching cube, with just one match of four codons to one cube only.
1/2 GGG
– CCC No other
3/4 CAT
– ATC - 39/40 CTA – TAC
5/6 AGA
– TGT - No other
7/8 CAC
– CTC “
9/10 AGG
– GGT - 43/44 GGA – TGG
11/12 AAA
– TTT - No other
13/14 GTG
– GAG - “
15/16 CCA
– TCC - 24/23 ACC – CCT Reverse Hex
17/18 GTC
– CAG - 53/4 CTG – GAC
19/20 AAC
- CTT - 46/45 CAA – TTC Reverse Hex
21/22 GCT
– ACG - 56/55 TCG – GCA Reverse Hex
25/26 GTT
– AAG - 33/34 TTG – GAA
27/28 ACT
– TGA - 62/61 TCA – AGT Reverse Hex
29/30 CGC
– GCG - No other
31/32 TTA
– TAA - 42/41 ATT – AAT Reverse Hex
35/36 TCT
– ACA - No other
37/38 ATG
– GAT - 49/50 GTA – TAG
47/48 TGC
– CGA - 59/60 CGT – AGC
51/52 GCC
– CCG - Matches itself
57/58 CGG
– GGC “
63/64 ATA
– TAT - No other
The 20 cubes required to make the above can also be further reduced so that only four cubes are required. Oh what a simple world. x
Sunday, 22 June 2014
Map 912 The Curves of The Crystals of DNA
Our first example is of the 1/1 - 9/9 Crystal.
ists of GCG, CGA, GAT, ATA, TAC, ACG, CGC,
GCT, CTA, TAT, ATG, TGC.
The
1/1 – 9/9 Crystal cons
The
higher smaller pattern is uniform in its colours. If you filled in
the blanks they would just be straight lines of vertical colour.
The
lower bigger pattern swops all T's for A's with C & G remaining
the same. C & G would be straight lines of vertical colours but T
& A swop over just as they do in the making of the twins of
Hexagrams.
This
pattern goes from North to South before it turns inwards and changes
the direction of reading again.
So
in both cases the bottom half is read left to right and the top half
is read right to left.
Lets
see what happens if we create the double crystal, does C & G
change or is it still T & A.
So does the horizontal remain straight and the verticals curve around themselves. I wonder. x
Saturday, 21 June 2014
Map 911 Perfoliate Growth in DNA
Perfoliate growth is when the plant is growing from the centre of the leaf if we look to DNA for the examples of growth from the centre we would be looking at 2/2 CCC, 8/8 CCG, 1/1 CGC, 4/4 CGG, 3/3 GCC, 9/9 GCG, 7/7 GGC AND 6/6 GGG all are DNA that grow around the centre of a direction chart. x
Friday, 20 June 2014
Map 910 Directions map in cubes
This is the Directions of DNA map as cubes but not as regimented they are allowed to be floating towards their destinations it looks them most like a flower this way. As we know hexagons are cubes at another angle and I think sometimes that cubes are the best way to portray DNA. In the Crystals we have 12 codons which equate to 5 cubes with a front, back and only one top and one bottom are visible. It doesn't mean they aren't there just that in the cube form of DNA we cannot always see what they are.
So if its water your after then look no further than the N.E. If it's fire your after look no further than the West. Water is controlled by Earth and Metal is controlled by fire so maybe they need to keep the elements under control because they have the most of them in those areas. x
So if its water your after then look no further than the N.E. If it's fire your after look no further than the West. Water is controlled by Earth and Metal is controlled by fire so maybe they need to keep the elements under control because they have the most of them in those areas. x
Thursday, 19 June 2014
Map 919 DNA Directions Map in Hexagons
Different sizes of 64 DNA codons in their usual sitting positions facing inwards to centre or their opposite points.
Map 919 DNA TGC and CGA Expanded in Jupiterian Fashion
As
we can see from the Hexagon above the outer edges are read as
follows:
Lower
TGC – Upper CGA
Six
hexagons within a six sided hexagon by the time we reach the centre
we read as follows:
Lower
ACG – Upper GCA
Now
we have four DNA codons.
TGC
- 1/7 – Hex 47 Cysteine … CGA – 4/1 – Hex 48 Arginine
ACG
– 9/8 – Hex 37 Met Start … GCA – 9/3 – Hex 55 Alanine
9/3
Is in the Double Crystal all others belong to the 1/1 Crystal
1/7
is NE facing SW – 4/1 NE facing SW
9/8
is NW facing SE – 9/3 SW facing NE
Three
of them are on the NE/SW axis and one is on the NW/SE axis
9/8
is known as the Start point MET the others create the amino acids,
cysteine, arginine and alanine.
As
each centre triangle pushes out it creates it opposite element as the
Hexagon gets bigger and bigger the outer edge is always the biggest
and presumably a more potent quantity of the amino acid is made. The
centre piece being 1 x 6 = 6 the second one is 6 x 6 = 36 third 36 x
6 = 216 fourth 6 x 216 = 1296 fifth 1296 x 6 = 7776 and finally sixth
7776 x 6 = 46656
So
a triangle at the centre has a value of 1 x 6 but the outer or 6th
ring has a value of 46656, by the time it is due to start again in
its 7th year it is new again hence the 7 year itch equates
to complete change.
![]() |
Monday, 16 June 2014
Map 918 S.W. and N.E. Directions of DNA as a mirror of its DNA and Nine Star Ki
6/9 Hex 14 9/6 Hex 13 Pair of Hexagrams
4/7 28 7/4 61
3/6 25 6/3 34
1/4 59 4/1 48
9/3 55 3/9 21
8/2 15 2/8 23
7/1 60 1/7 47
8/8 52 2/2 2 Alert this is not a match
So
from the point of view of the DNA cubes each three letter codon of
DNA matches to its opposite or switched numbers in Nine Star Ki. The
Hexagrams only match in two pairs. e.g. 6/9 is with 9/6 this switch
applies in all cases. Except the last. So for the direction 4/7 is
moving towards the centre where it will meet up with 7/4 are they
mirror images of their nine star ki numbers. If I was looking in a
mirror and I was 3/6 I would see 6/3. We know that mirror images
cancel each other out so although we have all this DNA it will all
cancel itself out and we are left with nothing at the centre. Except
for 8/8 and 2/2 which belong to a group called alerts because they
don't always conform to the usual patterns and once again they are
not conforming here.
Map 917 S.E. and N.W. Directions as a Mirror of its DNA and Nine Star Ki
9/1
Hex 63 1/9 Hex 40
8/9 56 9/8 22
7/8 41 8/7 31
6/ 43 7/6 10
3/4 42 4/3 32
2/3 16 3/2 24
1/2 7 2/1 8 Pair of Hexagrams
6/6 1 4/4 57 Alert this is not a match
So
from the point of view of the DNA cubes each three letter codon of
DNA matches to its opposite or switched numbers in Nine Star Ki. The
Hexagrams only match in two pairs. e.g. 9/1 is with 1/9 this switch
applies in all cases. Except the last. So for the direction 8/9 is
moving towards the centre where it will meet up with 9/8, are they
mirror images of their nine star ki numbers. If I was looking in a
mirror and I was 8/9 I would see 9/8. We know that mirror images
cancel each other out so although we have all this DNA it will all
cancel itself out and we are left with nothing at the centre. Except
for 6/6 and 4/4 which belong to a group called alerts because they
don't always conform to the usual patterns and once again they are
not conforming here.
Map 916 East and West Directions as a Mirror of its DNA and Nine Star Ki
DNA
Sitting in the West facing Centre or East
9/2
Hex 36 2/9 Hex 35 Pair of Hexagrams
8/1 39 1/8 4
7/9 38 9/7 49
6/8 26 8/6 33
4/6 44 6/4 9
2/4 20 4/2 46
1/3 40 3/1 3
7/7 58 3/3 51 Alert
this is not a match
So
from the point of view of the DNA cubes each three letter codon of
DNA matches to its opposite or switched numbers in Nine Star Ki. The
Hexagrams only match in two pairs. e.g. 9/2 is with 2/9 this switch
applies in all cases. Except the last. So for the direction 8/1 is
moving towards the centre where it will meet up with 1/8, are they
mirror images of their nine star ki numbers. If I was looking in a
mirror and I was 8/1 I would see 1/8. We know that mirror images
cancel each other out so although we have all this DNA it will all
cancel itself out and we are left with nothing at the centre. Except
for 7/7 and 3/3 which belong to a group called alerts because they
don't always conform to the usual patterns and once again they are
not conforming here.
Map 915 North and South Directions as a mirror of its DNA and Nine Star Ki
4/9
Hex 50 9/4 Hex 37
3/8 27 8/3 62
2/7 45 7/2 19
1/6 6 6/1 60
8/4 53 4/8 18
7/3 54 3/7 17
6/2 11 2/6 12 Pair of Hexagrams
1/1 29 9/9 30 Pair of Hexagrams
So
from the point of view of the DNA cubes each three letter codon of
DNA matches to its opposite or switched numbers in Nine Star Ki. The
Hexagrams only match in two pairs. e.g. 3/8 is with 8/3 this switch
applies in all cases. So for the direction 4/9 is moving towards the
centre where it will meet up with 9/4, are they mirror images of
their nine star ki numbers. If I was looking in a mirror and I was
2/7 I would see 7/2. We know that mirror images cancel each other out
so although we have all this DNA it will all cancel itself out and we
are left with nothing at the centre.
Map 914 We are all going Somewhere on the Wheel of Life
Imagine yourself on this wheel called Life. I am in the North East or bottom left hand corner second in from the centre. TGC. Always read the DNA as though clockwise. Does this mean I am relatively close to the centre of the wheel and not on a hairy ride on the outer edges. If you want to work out were you are on the wheel refer to Map 215 which converts Nine Star Ki numbers to DNA letters.
Map 913 DNA Codons of Directions as Squares
In
the square shapes there are only two angles 90* and 45* and the
Pikachu centre is now lost to a Hexagonal shape. The following is a
list giving the cube count for each of the elements and each of the
directions.
There
are 24 squares in each direction and 48 squares of each of the four
elements of DNA Fire T Orange, Tree/Air G Yellow, Earth A Green,
Water C Blue.
Maximum
and Minimum Elements in the Directions
The
maximum amount of Fire can be found in the South and also the W and
N.W. Now the metal areas are not happy to have fire there according
to the rules of Fire destroys or changes Metal, but if an alchemist
is at work it may be a different story.
The
minimum amounts of fire can be found in the S.W. Which is surprising
because isn't the South Fire supposed to support and create Soil
energy.
The
maximum amount of Air/Tree energy is found in the S.W. And yet
Tree/Air energy is controlling Earth perhaps this is why because it
is at maximum strength here.
The
minimum amount of Tree/Air energy is in the S. W. and N.W. Tree/air
supports and creates Fire maybe it is to cover the lack and W. and
N.W. Are usually controlling the Tree/air energy perhaps again
because it is at maximum strength.
The
maximum amount of Earth is found in N. the E. and the S.E. Earth
controls the North possibly because it is found in excess here, and
E. and S.E. Energies usually control the Earth because they are found
in excess here.
The
Minimum amount of Tree/Air energy is in the N.E. Which is an Earth
area and Tree controls Earth perhaps a little too much here.
The
Maximum amount of water is found in the N.E. Which is usually an area
that controls water, again because of its excess. This is more likely
to create the water falling from the top of a mountain so to excess
but so long as it keeps flowing not a problem.
The
minimum amount of water can be found in N. and E. and S.E. All areas
that benefit from having water.
We
can see the South, West and North West have the most fire and the
least Tree/Air.
We
can see the South West has the maximum amount of Tree/Air energy and
the least amount of Water energy. So it is being controlled by
Tree/Air so that it cannot overly control Water.
We
can see the North, East and South East have the maximum amount of
Earth and the minimum amount of Water. It looks like the Earth is
controlling the water situation so that the Tree/Air energy cannot
control it.
We
can see the North East has the maximum amount of Water and the
minimum amount of Earth. Water falling between a rock and a hard
place here, or creating a lake or river in order to best control the
water.
So
if you have a new idea and want to get it off the ground, what
direction would you take ? A new idea would be associated with
Tree/Air energy and I think we can see here that a N.E. S.W. Axis
would be a good place to be.
Sunday, 15 June 2014
Map 912 The Directions of The Codons of DNA
DNA
and their Directions
This
is a map of the DNA codons in their sitting positions facing centre
or opposite positions. E.g. TGC sits in the North East facing centre
or South West. There opposing codon is not the same matching pair as
you would find in the map of the 64 Hexagrams of the I Ching were TGC
1/7 matches up with CGA 4/1 in this direction map it's partner is AGC
7/1.
Is
it only me that can seee Pikachu at the centre?
Larger version:
Friday, 6 June 2014
Map 910 8/4 - 7/3 Crystal Earth, Tree, Metal in Lines
This is the 8/4 - 7/3 Earth, Tree, Metal Crystal as broken lines and again as solid lines.
Broken lines
Solid Lines
Map 909 6/6 - 2/2 Metal and Earth Crystal in lines
This is the 6/6 - 2/2 Metal Earth Crystal as broken lines and again as solid lines.
Broken lines
Always so uniform and simple for the 6/6 Crystal
Broken lines
Always so uniform and simple for the 6/6 Crystal
Map 908 1/1 - 9/9 Fire and Water Crystal as lines
This is the 1/1 - 9/9 Crystal that shows us the lines of the crystal as though they had stretched out, banks of colour showing a clearer view of the formation.
Broken lines image.
Lines completely filling in the blanks. Seek out the patterns within the patterns.
Broken lines image.
Lines completely filling in the blanks. Seek out the patterns within the patterns.
Thursday, 5 June 2014
Subscribe to:
Posts (Atom)











































