Map 919 World Cup Finals as a String of DNA

World Cup DNA

Lets take the dates of the World Cup Finals, change them into Nine Star Ki Numbers, then change them into DNA letters, just what kind of string of DNA would be produced as a representative of the World Cup Finals and what could we make from them.?

1930 7/3           1966 7/3           2002 7/4

1934 3/1           1970 3/1           2006 3/9

1938 8/7           1974 8/6           2010 8/6

1942 Wartime  1978 4/4           2014 4/3

1946 Wartime  1982 9/9

1950 (2) 5/6     1986 (2) 5/7

1954 1/3           1990 1/3

1958 6/1           1994 6/9

1962 2/7           1998 2/6

Sometimes the Final is played in June and sometimes in July hence the variations on the theme. Number 5 is represented as male, I don't think anyone will quibble with football being more masculine than feminine.

Then we have the two dates in 1942/6 that are missing for wartime, do we leave them out altogether because those games are not a part of the DNA of World Cup Finals. I would say yes. Potentially you could add two STOP markers, or even 1/1 water plus water as the lightest of coverings or even a portal. Last but not least you could put in the DNA markers for 4/4 and 9/9 as they would have been the dates they were played. As this is a map of actual world cup finals for me I would leave them out all together. There are no gaps in DNA, as far as we know. 

So what do we get as a string of DNA to describe the World Cup Finals.

GACATCTTATTTTACAGATACAGATTCGACATCTTGCGGGCGTTCTACGAGTTTAGTGCTTTGTAA

So what could we make from this DNA. Enjoy the world cup wherever you are in the world and know that we are all a part of the whole. X