Crystal Clear Living

There are five different crystals of DNA 3 with 12 codons, 1 with 4 codons and a double crystal with 24 codons. This image shows us the single cube and the double floating about in the air full of potential for life. Genetic information stored inside them, desires waiting to be born. Your own codon belongs to one of these crystals.......mine 1/7 TGC belongs to the 1/1 – 9/9 Fire and Water peaked crystal. So my particular crystal has a desire to be a certain way and attract into my life the lessons I need to learn and the messages I wish to deliver. Notice the matrix running through them and when the time is right the opportunity presents itself. Make sure you are ready for all that life will throw at you and that you can say I made a difference in this world. Just being here means you make a difference but to be a major player like Stephen Hawking............. However difficult life may seem there is always something you can do and succeed at........Steve Jobs....... everything around you that you call life was made by people who are no smarter than you........and it is not even necessary to be called Steve. Live that life the precious gift you have been given to the best of your ability.

  

DNA Codons in Triangular Form in The Universe

Image this energy swirling above the Universe constantly seeking out its matching partner for creation............what a wondeful colourful life we all lead. x

Its is tiny and invisible to the eye but its there. x

The Ho Tu I Ching Map and its planetary positions

This is a map of The I Ching Diagonally from the top 2/2 corner to the bottom 6/6 corner showing the planetary combinations with the map. This is the Ho Tu or The Word DNA map based on the numbers 28143976........

                 

Sometimes its easier to see patterns within small or larger images.

If you fold it over at the middle point you will see it still forms 

patterns of sorts that can guide you. 

Another variation on the same theme is a diagonal map of The I Ching in numbers only...

DNA Triangles

Can we really imagine a world with little triangles invisible to the eye floating around us in preparation for making whatever it is that we wish to attract into our lives in order to live the inheritance our DNA has given us.  Some pointing upwards others pointing downwards..........when they meet they make beautiful music together.

Life in action x

Nine Star Ki with 9 at Centre

The above Bagua is based on the number 9 at the centre

3 – 6 – 9 alternate across the diagonal line from North East

to South West. No matter how big the bagua becomes 3 – 6 – 9

will be the only numbers that appear in that diagonal. As you

can see the 9 Purple pieces create a pattern of their own so when

you make up a map you can check you have them right if the nine

parts pattern is the same as the centre number and the diagonal line

will always be either 1 – 4 – 7 ….. 2 – 5 – 8 ….. or 3 – 6 – 9 again

dependant upon the centre number. A quick glance of correction.

You can make up all six sides of the bagua and if you remove the

number at the centre and all of its parts..... there will be nine gaps

in each map..... a water feature with the water pouring out of the

gaps would be beautiful. No matter what number is at the centre

the same waterfall would occur............so much difference and yet

they have so much in common.

Should you wish to create your own jigsaw you can choose from

nine of the above colours and numbers to make up the 81 piece

 jigsaw.

Aspects in the Patterns of DNA Codons

Aspects of Love

All aspects whether easy or difficult are created by love.......love is everything and that means good or bad. So if some aspects are easier to cope with than others it may mean your life is blissfully easy and you achieve very little. Or if they are more difficult to get a handle on it could be the makings of you. No aspect pattern in my opinion is any better than another, only different. You may have certain energies that need to be released and this is your inheritance to release them in the way of the aspect pattern you are born to. Embrace that aspect whatever it may be.

Lots of red in your aspect shape and you are born to act be decisive.... hardworking, actions speak louder than words, you can get things done. If a job is worth doing its worth doing well and if you need something done ask a busy person, thats you. Make time for yourself too. A little green and blue will help you to work, rest and play.

More blue and you are talented, gifted and a little bit too laid back sometimes, you could take your talent for granted or let it go by unnoticed because your too busy on the mundane things of life like making a living. Wealth would be an advantage here so that work does not get in the way of your talent. Alternatively if you can work at your hobby and make a living can it really be considered work. Add a little green and red and you can get your creativity out there.

Green......contemplation on a theme.........then you realise the variations on that theme......before you know the day has passed you by......thinking, pondering and hopefully realising all belong to the green energy. You can absorb information like a sponge, stopping and doing something with it is the key, constant learning can be a pleasure but it can also be pulled together, a little bit of information here added to a little piece of information there and you have something new. Add a little blue to the mix and you have a talent for discovering something new.........add a little red and you might be able to do something with it.

Red, Green and blue and you have the ability to think it through, act on it and manifest it. So if you have The Worker aspect all red, you are going to be busy always doing something, even if its only pottering.......try to make time for rest and play. For example reading could bring in a bit of green energy whilst still keeping you busy.........crafting or gardening could bring in a bit of blue whilst once again keeping you busy. Attract the colours you need in whatever ways you can think of.

All blue you are creative, if you create a garden there will be little chance of you being able to maintain the beauty of your artwork without putting in the effort to work on it hence you can bring in a little red energy. Maybe redesigning could give you a little green. Finding the ways to use everything you have brought with you into this life, your inheritance wants to be delivered and you should do all in your power to see it through.

Lots of green full of ideas but the splash of red will keep you busy bringing those thoughts to life, add a flurry of blue and you can manifest them too.

Whatever colours dominate for you the lack will be attracted to you and the excess has the potential to overwhelm........find balance in all things and enjoy every minute you have here on planet Earth.

The Trine... 120* x 120* x 120* is a equilateral three sided triangle thus it creates aspect lines in the same element. The Triangle could be Fire, Water, Air or Earth focussed. In a birth chart it creates a 360* full aspect and in The I Ching the four corners of The Ho Tu or The Word contain all four elements trines. The grand trine........eeeh life's Grand.........and it is because your a very talented person born with skills you need to use rather than improve on. If you are too easy going you may miss opportunities because you don't realise just how talented or skilled you are and take it for granted. You really do have a talent use it.

Blue energy is considered fixed so again that doesn't make you as flexible as you could be......or as outgoing as you could be. Peaceful, calm, laid back is all well and good but talent left to go latent is such a waste. Make sure that your inheritance and talent is given out to the world.........deliver what you came here to bring.

There are four examples of The Grand Trine...

CCC 2/2 Proline

TTT 2/6 Phenylalanine

AAA 6/2 Lysine

GGG 6/6 Glycine

Placed at all four corners of The I Ching

The Alternator...180* x 120* x 60 is a triangle of red, blue and blue energy so this aspect will alternate between being laid back and being busy. Work, play, work, play, with no rest in between. You have to be careful you don't overdo it and then need play time to recoup your energy. Exhaustion is a possibility. The outlet for fun and play is where the two blue lines meet and the hard work will be connected to the houses and signs that the opposition line crosses. The red line is an opposing line but if they can meet each other half way there can be balance and harmony and the hard work will be something you enjoy doing even if at times it can be exhausting and you can fall away into the blue aspect point whenever it gets too much. Activity keeps your engine running too much play can also leave you drained. If you allow yourself to get too laid back you may not be able to motivate yourself again. So balance in work and play is required.

There are twelve examples of The Alternator...

TTG 8/6 Leucine

TGT 1/6 Cysteine

TGG 4/6 Tryptophan

GTT 3/6 Valine

GTG 9/6 Valine

ACC 3/2 Threonine

ACA 9/2 Threonine

AAC 7/2 Asparagine

CAC 1/2 Histidine

CAA 4/2 Glutamine
CCA 8/2 Proline

Note how all of them appear to the outer Vertical edges of The I Ching.

The Worker...180* x 90* x 90*......Also known as the T square ….busy, busy, busy. You are a hard worker there can be no doubt of that, if a job needs to be done you will make sure that it is. There is a lot of active energy here and finding time for rest and play can be difficult. Think workaholic. There is the potential here for overactivity symptoms....because you don't make time to relax. If you can find a hobby you love that you can make a living out of then you are in seventh Heaven, doing what you love and making a living from it. The house or sign where the two 90* aspects meet could be an outlet for these energies. You may be required to do physical work but if it is more mental work then join a gym or take up a sport to release some of the energy here. A build up of unused energy could prove explosive. Cardinal highly motivated energy must get something done.

There are seven examples of The Worker in DNA codons:

TGA 4/7 Alert Stop Opal

TCA 8/3 Alert Serine

ATG 9/4 MET/ start point

ACG 9/8 Threonine

CGA 4/1 Arganine

GAC 7/3 Aspartic Acid
GAT 7/9 Aspartic Acid

Two alerts which mean they don't conform to the standard the way other codons do......one Stop point and one Start Point and two others that have conform to the usual standards. Otherwise nothing outstanding about the position of them in The I Ching.

The Ruminator...180* x 150* x 30*.....red, green and green energies. A lot of thinking and action here. Stress and anxiety could result and energy is best released at the point where the two green lines meet. The house and sign will give you an idea of how best to utilise them. Ruminator's work on a high level of focus......Sherlock Holmes would be a good example.....he will focus on a problem until he resolves it. Scientists will look at the same problem for years and keep going back to it until it is resolved and often times when they do they can bring something new into the world. Creativity and originality are commonplace with this aspect, intelligent energy being used in an intelligent way. Whatever it is they focus on it will take them on a journey along the way they will absorb a bit of information here and another bit there and collectively they can fit together and become more than the sum of their parts. The journey can take you to the edge of The Field and if you just push back the envelope that little bit further you could well find the Holy Grail. Something that is already out there just waiting for us to re-discover it. The Holy Grail is something that exists but is hidden and The Ruminator is well fixed to find it. That focus held for so long will prove worthwhile in the end and something new and amazing could be discovered.

There are six examples of The Ruminator in DNA Codons...

CTG 8/4 Leucine

CTA 8/1 Leucine

TAC 1/3 Tyrosine

TGC 1/7 Cysteine

ACT 3/8 Threonine Alert
GCT 3/9 Alanine

Just one alert amongst them. No particular positions in The I Ching.

The Magician...150* x 150* x 60*... also known as The Yod or Finger of God. Fate plays a hand here. I think it looks like a projector showing you the way of the world based on what you project onto it. Until ego is under control you could cause mayhem or things will feel stirred up and uncomfortable. Creative imagination is at work here so would be useful for an actor to project his memories into a role to bring it to life, this is called Method Acting. If you have a memory of just the feelings you need to bring to a role you can project them into the part you are now playing. The two green lines meet and form the all seeing eye giving flashes of inspiration. The power of creative visualisation must surely be strong here. Maybe blue and green energy needs a little bit of tornado to stir it up every so often or it may be happy to sit and watch the projector playing out the film rather than making things happen the way you want them to. Now thats magic. Alternatively every time you dig up a past memory and relive it you are potentially experiencing those feelings in your body all over again. If The Magician can create on screen the life they want for themselves then they should choose the roles that make them happiest.

There are six examples of The Magician in DNA Codons...

TAG 4/9 Stop Amber

CAG 4/8 Glutamine

GTA 9/7 Valine

GCA 9/3 Alanine

AGC 7/1 Serine

AGT 7/4 Serine Alert

Just one alert here and no particular position in The I Ching.

The Lecturer...90* x 150* x 120... red, green and blue.......work, rest and play. A balanced energy. Think it, act on it, manifest it. This aspect is bigger than the Teacher and thus it is called The Lecturer. Big life lessons to learn and much to teach others as you pass it on. Sometimes it will feel as though the same lesson comes up for you over and over again and yet you feel you have learned from past mistakes.....so why are you still making them. Until you learn how to cope with whatever it is life throws at you you will be forced to repeat the lesson. There is a karmic feel to the lesson.......you have been here before and didn't manage to work it out. Do so now and pass on the knowledge that you learn.

The house and sign associated the the three points will give you some clues as to the probable areas. There is much to be gained here when you have an understanding of how the energy works for you. You can can think it, feel it and manifest it with these energies.

There are seventeen examples of The Lecturer in DNA Codons...

TTA 8/7 Leucine

CCG 8/8 Proline Alert

CGC 1/1 Arginine

TAT 1/9 Tyrosine

TAA 4/3 Stop Ochre

CGG 4/4 Arganine Alert

ATT 3/4 Isoleucine

GCC 9/9 Alanine

ATT 9/1 Isoleucine

GGC 7/7 Glycine

GGA 6/7 Arginine

GAG 6/9 Glutamic Acid

GAA 6/3 Glutamic Acid

AGG 6/4 Arganine

AGA 6/1 Arganine

AAG 6/8 Lysine

In no particular order in The I Ching. Two of them marked as alerts.

The Teacher … 90 * x 150* x 60*...You love to learn purely for the sake of it. You love to pass on what you have learned too. Red, green and blue again but without the karmic connection...you know how to work, rest and play. Your gains may not be as huge as the Lecturer but you will gain so much from the proper use of these energies. Learning from the Teacher is easy and you can then go into further education if you choose.......everyone you teach something improves there lives and that in turn improves yours. Your a natural born teacher with a lot to offer.

There are five examples of The Teacher in DNA Codons.

TCG 8/9 Serine

CAT 1/8 Histidine

CGT 1/4 Arganine

GTC 3/7 Valine

ATC 3/1 Isoleucine

In no particular position in The I Ching.

The Thinker...150* x 120* x 30*...green, blue, green, very laid back thinker here. Similar to the Ruminator but without the red energy that can make sure you get that information out there. Don't spend so much time in quiet contemplation that you forget to let the world know what you have discovered along the way. Perfect if you live in a Monastery......or have a Professorship at a University that pays you to think.......for most of us it could become idling away the hours, creating nothing bad in the world but the world could be a better placed if it could get its hands on your ideas. You absorb a lot but don't necessarily put it back out again. The Point where the two green lines meet could be the best way for you to put the information you have absorbed back out into the world. It would be a shame to waste such pure thought. Thoughts are alive too and are attracted to your ability to think so deeply but they also want to be born, don't let them down.

There are six examples of The Thinker in DNA Codons...

CCT 2/8 Proline

CTC 2/1 Leucine

CTT 2/4 Leucine

TCC 2/3 Serine

TCT 2/9 Serine

TTC 2/7 Phenylaline

All positioned on the top horizontal line of The I Ching.

So there we have it just eight shapes of DNA or aspect. The Trine, The Alternator, The Worker, The Ruminator, The Magician, The Lecturer, The Teacher and the Thinker.

Astrology charts are in twelve sections starting with the 1^st house through to the 12^th house. The DNA codons are made up from the date of birth of the person which can be found in the maps marked Nine star Ki Numbers for the year number and then move to Nine Star Ki month Numbers for the second number.

My birthdate is 15^th March 1954 so I look to the year chart and find that year in column 1.......then in the month chart I find the number 1 across the top move to the month of March and find the number 7 here and the DNA Codon letters TGC.

	First	Second	Third
T	Aries	Leo	Sagittarius
A	Taurus	Virgo	Capricorn
G	Gemini	Libra	Aquarius
C	Cancer	Scorpio	Pisces

Codons are made up of three letters, my own being TGC gives first T Aries – Second G Libra – Third C Pisces – thus creating a Ruminator's aspect from the 1^st to the 7^th to the 12^th house and then back to the 1^st house. 180* x 150* x 30*

So this aspect is about relationships between you and I the 1/7 houses.....then on to the hidden enemies and deeply spiritual nature of the 12^th house. Much to Ruminate on here. Read up on Aries – Libra and Pisces and fit what you find to the potential available in this aspect pattern. The outlet is in the 12^th house …. I believe.....deep sensitivity... dreamy....empathic and artistic. So I am (Aries) I balance (Libra) and I believe (Pisces). I think I will take from that I believe I am balanced. At least in these later years......or perhaps I balance what I am with what I believe. 

Randomly I choose TTG which is Aries – Leo – Aquarius...... 1^st - 5^th and 11^th houses.....120* x 180* x 60* This forms the Alternator aspect. The outlet for this codon is the 1^st house. 1^st I am an entrepreneur passionate about my interest … I will succeed, be proud and talented...I know....I am open to making discoveries in unusual ways...very unconventional. I am (Aries) I will (Leo) and I know (Aquarius).........I know I am, I know I will...........

CGA – Cancer 4^th house – Libra 7^th house – Capricorn 10^th....The Worker aspect.......the outlet for the aspect can be found in the 7^th house of Libra. Balance in all things. Cancer I feel – security needs – psychic.....Libra I balance … sees both sides can be gullible but fair...Capricorn I use...serious minded... hard working.....traditional...... I feel (Cancer) I balance (Libra) I Use (Capricorn).........If I remain balance I feel I can use all the tools at my disposal.

All Codons can be detailed much further this way. 

Answer to Quiz Question

I am the light

Artistic Synaesthesia

Heaven and Earths

Hearts Desire

Well done if you worked it out. x 

Each DNA codon is an Amino Acid and each amino acids is also represented by a letter and each letter combines to make a new word. Simple. x 

Convert the DNA Code

A quiz for the half term can you convert this DNA sequence into something other than Amino Acids.

ATC GCCATG ACCCACGAA CTCATCGGCCACACC

GCCCGCACCATCTCCACCATCTGC

TCCTACAACGCCGAATCCACCCACGAATCCATCGCC

CACGAAGCCGTCGAAAAC GCCAACGAT

GAAGCCCGCACCCACTCC CACGAAGCCCGCACCTCC

GATGAATCCATCCGCGAA

The Answer to the code will be found on the next post. Enjoy x 

The I Ching - DNA Codons and Crystals - 1/1 - 9/9 Fire and Water as Jewellery

                               Creating Jewellery from the world of DNA Codons and Crystals 

1/1 – 9/9 Crystal

TGC – GCG – CGA – GAT – ATA – TAC – ACG – CGC – GCT – CTA – TAT – ATG

DNA Codon TGC

The 12 codons above are the codons of the 1/1 – 9/9 Crystal

36 Letters in all in order to reduce the above in true Saturn style

note how you can still create the same codons if you remove the repeating

letters within the codons.

For example TGC – GCG – CGA

can be reduced to TGC – G – A so instead of

9 letters we have only 5 to complete the whole sequence we end

up with only 12 and not 36 letters.

Even as we read the reduced letters they still make codons

that can be found in the 1/1 – 9/9 Crystal

TGC – GAT – ACG – CTA – TAT

then we have TG to start over at the beginning again.

So Saturnian style we can reduce the crystal by two thirds

we have only 12 letters now not 36

As a bracelet it becomes a strap of just 12 gems but

it can display all 36 by stretching it our again

in a Jupiter manner.

So you can make a necklace with all 36 parts of the 1/1 – 9/9 Crystal in

full and natural size and then make a reduced size bracelet of only

12 parts............as there are 12 codons in this crystal it could be used

for any of the 12 Hexagrams or Codons that they create. There are

3 x 12 codon crystals (36) 1 double crystal (24) and 1 small diamond

shaped crystal (4) making a total of 64 Codons altogether which can

be represented by just 5 crystal combinations.

If we add gold links between the gems to create the size of bracelet required

the beginning and the end of this row would be linked up into a circular

bracelet shape. You could add a vertical row of three letters to denote your own codon

in my case TGC. Earrings could be just as the vertical portion and a necklace could

also add the vertical portion or create a cross shape from the three letter codon that is you.

The potential for 5 different parts of jewellery.  

Variations on the theme of the 1/1 - 9/9 Crystal

Variations on A theme of the 1/1 Crystal

The loose crystals above are waiting to be brought together ….. the left hand side is Hexagonal shapes on top of each other creating a barley twist effect.....

then I have pulled them a little closer together in the centre.....and finally a tight fit makes for a smaller set of codons so they seem as light as air in comparison so I have added a ribbon to make them look like balloons.........x

Information card for the Codon TGC in the I Ching

A closer look at things that might give us an insight into a particular codon. This one is TGC.....
imagine it as a playing card with information on each side.

More information can give you opportunities to check other areas...............discover yourself. x

The Ruminator - The Holy Grail

The Holy Grail – The Ruminator

We are on a quest to find the Holy Grail...........a quest in our case can become a question....we do not need to leave our armchairs to seek out the Holy Grail. For me the Holy Grail is Astrology, Feng Shui, The I Ching and DNA. Many have searched and concluded The Holy Grail to be a beautiful golden cup studded in gems, perfect for wine, yet still it has never been found. What if the Holy Grail is something completely different. There is an aspect in astrology I call The Ruminator an aspect of 180* x 150* x 30* from any starting point. It has two green aspects, so much thinking will go on here and one red aspect giving you the energy to see it through.......no blue energy though and that is the nature of the Ruminator.......they focus on something to the exclusion of all else until a discovery is made. Sherlock Holmes is a Ruminator once on the track of something he would not let go until he solved the riddle. If it takes a lifetime a ruminator will think on that same subject for as long as it takes.

Let us look at some of the people who have discovered Holy Grails.....

Albert Einstein, Nikola Tesla, Michael Faraday, Alfred Nobel, Alan Turin, Stephen Hawking to name but a few............

Fusion could be said to be created at the point where the two green lines meet releasing a volatile explosive energy, something new and original can be created from this energy. You have pushed back the envelope.......gone to the edge and just pushed those boundaries a little further stepping into The Field and discovering something hidden, just ripe for the picking. You can make discoveries never before seen on Earth. They were there, hidden and ready for discovery when the time was right and when the Ruminator has ruminated long enough. The Holy Grail is not likely to be something discovered overnight you have to put in the hard graft before hand and you have to love what your doing so much that its no hardship to spend every waking hour thinking about it. You have to believe in your own ability and absorb information as it comes to you, on its own the information may mean very little but over a period of time a little bit of this added to a little bit of that makes the whole thing come together. For me I know the information is right if it conforms to a pattern... if it doesn't conform I call it an alert........don't throw away previous thinking but find ways to adapt the alert to fit. So if you have something you find interesting let it absorb you and you it and one day another Holy Grail will be born which could change life for mankind well into the future when that Grail is born. x

The Ruminator in the TGC position.

For me the Ruminator is a very good description of TGC T is in the 1^st House of Aries the house of the pioneer.............G is in the 7^th house of relationships and Libra............and C is in the 12^th house of Hidden things and Pisces.

I am never happier than when I have something new to think about and if I think on it for months and then find it to be nonsense I have still enjoyed the journey. For me the Ruminator may be about matching up the you and I.....making pairs and adding information to the thought processes which take me into the hidden depths of Piscean oceans. Whatever I come up with the energy will be created in the 12^th house of Pisces and I will need to take it shape it and create a new form for that new idea. 

Nine Star Ki Cube

Perspective is amazing each of these triangles is the same size just seen

from a different angle. 

Each connection comes from The North to the South to the West

showing us that North is South and East is West again dependant

upon the angle of my perspective. The Inner workings of Nine

Star Ki is dynamic and triangular in shape (red) whereas the four

corners create the X Factor Cross (green)

Thinking inside the box with Nine Star Ki. 

All 6 Crystal of the 64 codons of DNA combined

                                   6/6 – 2/2     1/1 - 9/9        Double       8/4 – 7/3        Diamond

Firstly let us look at the orderly way the 6/6 – 2/2 crystal is presented in such an orderly fashion. The 6/6 contains no 1's or 9's and and is all about Heaven and Earth. The 1/1 – 9/9 crystal is associated with the 6/6 – 2/2 crystal because it contains no 6's or 2's. Associated by the lack in each other. The 1/1 – 9/9 crystal is more randomly placed in appearance. Both are vertical by nature and if they had to find someone to pair up with they would choose each other.

The Double crystal is horizontal by nature and they connect together in so many ways but the Hexagram numbers make it impossible to consider them separately. They are a pair at all times. A relatively orderly pattern exists.

The 8/4 – 7/3 Crystal is vertical and it pairs up with the smaller diamond crystal which is centred so is neither vertical not horizontal. The strong connection to the numbers 3, 4, 7 and 8 make these two wish to pair up.

Together they form all 64 Codons of DNA............64 Hexagrams........and all versions of the combinations of the letters T G A C.

The six crystals also fit well within the pattern of the diamond crystal at the centre surrounded by its pairing the 8/4 crystal........then comes the double crystal...........then the near outer is the 1/1 crystal and the very outer reaches of the chart is the 6/6 crystal...........the Heavens. The record of life shows this nicely. Life has a record of everything that ever was and will ever be..............lets make beautiful music together.  

Double Crystal in a Jigsaw Pattern Bracelet

Whilst the double crystal makes two separate 12 codon bracelets it is noticeable that they are inseparable when we tie in the Hexagram numbers........the double crystal also appears to be horizontal rather than vertical as the others are. So I would keep these two parts together like
twin peaks of a church. It makes for a more expensive bracelet with 24 codons to present but
maybe the Double crystal can afford it.

Diamond Crystal in a Jigsaw Pattern Bracelet

This is a Jigsaw Bracelet made up in the pattern of the Diamond Crystal but this has only 3 parts each of T G A and C. Note that with this crystal there are only 12 parts not the usual 36 parts now this bracelet could be made in many ways as it is with just the 12 parts or we could repeat the 12 parts 3 times to create a 36 piece bracelet. I prefer to make it 12 pieces but bigger than the previous jigsaw parts.............each can contain one full month of time instead of three parts per month of the other crystals. There is no doubt about it the diamond crystal contains only 4 codons so I see no reason to make it into 12.

8/4 - 7/3 Crystal In a Jigsaw Bracelet pattern

This is a Jigsaw Bracelet made up in the pattern of the 8/4 - 7/3 Crystal 36 parts 9 of each T G A and C. Note how precarious life can be. There is more randomness to this bracelet than there is to the 6/6 bracelet.

6/6 - 2/2 Crystal in a Jigsaw Pattern Bracelet

This is a Jigsaw Bracelet made up in the pattern of the 6/6 - 2/2 Crystal 36 parts 9 of each T G A and C. Note how precarious life can be. Note how much more orderly the 6/6 crystal patterns are compared with the 1/1 Crystal.