Saturday, 11 October 2025

The changes from Crystal to DNA Codons and Hexagrams in The I Ching In 6/6 - 2/2

 

So here we have the position of the Hexagrams in the 6/6 - 2/2 Crystal……..Hexagrams with odd numbers below the line and Hexagrams with even numbers above the line…….now lets see what changes occur when they pair up for DNA rather than for Hexagrams. 


Now in the 1/1 - 9/9 crystal they remain above and below the line for their Hexagram numbers but in this case of the 6/6 - 2/2 crystal they do not. Suddenly not all of the connections create a hexagonal shape. This crystal is usually very uniform so it surprises me to see it so unbalanced. X 

The changes from Crystal to DNA Codons and Hexagrams in The I Ching in 1/1 - 9/9

 Here we see an example of what I call the 1/1 - 9/9 Crystal……….first of all set out as it would be paired in the crystal….


Here we see the pairs of codons that match up ….

TAT Hex 64     GAT Hex 38       CGA Hex 48     GCG Hex 30    TAC Hex 40    ACG Hex 22    

ATA Hex 63    ATG Hex 37       TGC Hex 47      CGC Hex 29    CTA Hex 39    GCT Hex 21


In the crystals they partner with the Hexagram numbers rather than the DNA Letters so these are the partnerships we see here. Lets look at how that changes when they match via DNA not Hexagrams. 



Changes between them are shown below…notice how they still pair up one odd number one even number creating a hexagon. 


Its hardly surprising that DNA Replication has so many ways to go wrong. The letters with C or G in them remain the same but in Hexagrams C and G do not always change they can remain the same as we can see here. I add the ribbons as an idea that they are strung onto it and the odd numbers of the hexagrams are below the line and the even numbers are above the line. This does not change even when Hex and DNA compete. The Four cardinal points North, South, East and West, or AC, IC, DC and MC remain unchanged in this crystal. In other ways there are no changes and the 1/1 - 9/9 crystal has no Alarms it is fairly straight forward although more colour combinations than the 6.6 which will follow to show you the differences. X

The Floral Patterns of Nine Star Ki 1/1 or DNA Codon CGC and their Centre Positions


This is a map 27 x 27 squares or 9 x 9 squares or merely 9 squares of DNA Codons and Nine Star Ki based on the Nine Star Ki 1/7 or DNA Codon TGC being at the very centre. From there we pan out and each of the pink roses is positioned where the 1/1 CGC squares appear………1 being the dominant year number.

Notice how the top left hand or south east corner matches as a mirror image of the top centre of south area…..other pairs are East or middle left pairs with North or Middle bottom row…….Middle right hand row or West pairs with bottom right hand row or North West……North East bottom left and the centre pair up…….and finally no partner for the double 11 position when it is at the centre .

The thing with patterns there is always one available and if you get pairs that don’t match up completely or in reverse then you know you have made a mistake……….. All of the rosettes above are positioned in a 1/1 position and every set of nine will have one but each will be his from a different direction so making it different in that way. Are they black holes…….water spirals pulling things in…….I have yet to decide but as rosettes they can at least be seen as beautiful. Enjoy your thinking. X  




Notice 1/1 when at the centre is hit from four angles…..also any on the outer edges will also be hit from other sections so not necessarily only once as it shows here. 



Friday, 3 October 2025

The Sun Sign Qualities of Aquarius and Pisces

 A closer look at the sun signs…..

Aquarius - G - third and final Air/tree position - Planet Saturn (shares with Capricorn) - Musical note A# - 11th house position - I know - this is all about the knowing - Solfeggio 639 and 852 - 20th January to 18th February - Fixed sign - Innovative, humanitarian, progressive, technology whizz kid, big thinkers who want to improve the world, don't always show empathy on a 1 to 1 basis, life on land or in water, water bearer, mystical healer, unconventional, inspire others to follow their lead for a better future, care about social justice, the environment, unafraid of change, seeking to improve everything they can, push boundaries, unique thinkers, like to be different rather than blend in, care about humanity, see emotions as a weakness, revolutionary, with high ideals. Creative intellectuals, like their independence even in a partnership, Not good at taking instructions from others they have enough ideas of their own and never lack inspiration or the next big idea. Not big on social occasions unless a group meeting up to discuss things they might have in common. Don’t try to tie them down or they will break free, they love to be in a relationship so longs as no cords are involved. Set me free and I will come back to you. 

Pisces - mutable - water - C - Third and final Water position - 12th house - Musical note B - Solfeggio 741 and 639 - Planet Jupiter (shares with Sagittarius) and also Neptune which dissolves all boundaries- feet - I believe - I believe for every drop of rain that falls a flower grows………very romantic view of the world - Je Crois - The Cross or crucifix - I believe is to accept something as the truth without evidence that is tangible - I believe in God for example. Je Crois - Croire en dieu - Imagine what you can believe - Crois en toi - and then make it happen. I believe in you. Oftentimes a cross is used for a monument to something or someone as a reminder. If I believe in you then I must also believe in myself. Imagine a cross with I believe in you written on it. The final culmination of all twelve signs and lessons, embodies traits of empathy, compassion and creativity. Two fish swimming in opposite directions or are they if you draw a circle around them you will see they are swimming in the same direction, oh boy can Pisces confuse us. Deep emotional sensitivity, artistic, navigates the deep blue sea of imagination, big dreamers versus being mindful of reality can create a tendency to get lost. Connect with others through emotions and puts the needs of others first. Vivid inner world, art, music, etc., Understands life's deeper mysteries and emotional currents. HSP’s and can be affected by the moods of others never sure whose feelings belong to who. Yearns for a connection with realms beyond this planet. Pisces are said to live in two worlds, illusion and spirituality, luck and expansion. Can be emotionally overwhelmed hence they seek an inner world which is more peaceful. A monastic life would be perfect for them. So trusting they can be taken advantage of by less evolved beings. Mystical, romantic, a personal therapist for all. They know how you are feeling and never judge listening carefully. Turmoil is often the end result when chaos arrives and thiings get out of control. Melancholy for others who do not make the most of their lives and sorrow can actually become a motivation for creative arts like poetry and music. Beautiful dreamers. 


The End…….Le Fin……Finish……..the last sign before beginning again. We can lower our tones by going back one sign and raise our tones by going up one sign but Pisces would move into the next Octave for Aries if it raises its tone hence the idea that they live in two worlds, or two scales ending on Pisces and Beginning again with Aries. Enjoy your thinking and be you, do you and don’t let anyone else tell you how to do it. X 


The Sun Sign Qualities of Sagittarius and Capricorn Sun Signs

A closer look at sun signs…..

Sagittarius - T - Fire - Third and final fire position - Mutable - 9th house - Planet Jupiter (shared with Pisces) - 22nd November to 21st December - Solfeggio 852 and 741 - Musical note G# - I perceive - Je percoise - perception - sensory information helps you to understand facts - signals go through the nervous system stimulating the senses - mind work - How we perceive the world is how we function e.g. bodily movements - symbols - e.g. Ah I see - Eureka ! Once you know something you gain knowledge which is what Sagittarius is all about. You are optimistic, freedom loving, adventurous, honest and have a love of travel. An open mind seeking knowledge with little arrows piercing the sky from the Archers bow, also an anchor is a symbol for Sagittarius and knowledge gives us that anchor. Passionate, philosophical, enthusiastic, impulsive, blunt at times, restless and do not like to be restrained in any way. You have a sunny disposition thinking don’t worry The Universe will provide. You resist if there are too many rules. You are an explorer, enjoying new cultures and places. You value the truth and like to be straight forward which is when being a little too blunt can come in and it can make you seem tactless. You have a thirst for knowledge and are greedy for degrees. You are described as being a big hug type of energy. You have good luck most of the time and bring humour into things, you're enthusiastic and try to avoid being impulsive which is a good thing. You get bored by routine as your interests need to be stimulating. You are curious and idealistic, inquisitive with a need for space in personal relationships. 

Capricorn - 22nd December - 19th January - Planet Saturn (shares with Aquarius) - Cardinal -  A - Earth - third and final position of Earth - I use - I utilise - 10th house - third and final position of Earth - Musical note A - Solfeggio 741 and 639 - Sea Goat - Practical, hardworking, disciplined, ambitious, grounded, leaders, visionaries, goal orientated, loyal, honest, direct, have high standards and expect it in others - understands reality - driven, C.E.O. Users, responsible, don’t sugarcoat anything, make things happen, the body of a goat and the tail of a fish, can navigate land and water, materialistic, emotional at times like its opposite sign Cancer when they become out of balance - can appear cold due to desire to control without taking on too much responsibility, stubborn and can hold grudges, creating a secure life, cherishes close relationships (home life) driven to succeed, know what makes people think, determined, reliable, make things happen, more practical than emotional, negatives can be a workaholic so determined to succeed, lacks forgiveness, strong connection to the material world, make solid plans, driven by desire to achieve, stubborn and at times pessimistic. Betrayal is unforgiven. Find it difficult to express emotions or show vulnerability.  

The Sun Sign Qualities of Leo and Virgo Sun Signs

A closer look at sun signs…..

 Leo - T - second Fire position - Fire - Fixed -  Planet Sun - E musical note - I will - Heart and spine - to be going - July 23rd to August 22nd - Solfeggio 3-9-6 and 2-8-5, 5th house, Je Vais - Ich werde - I am going which creates future tense (Je vais) - Je vais aller I am going to go - Je vais - I go (present tense) - Je vais aller - I will go (future) - Leo in french is Lion - Sun of God - confidence - self assured - sunflower - I am a lion - Heart / spine - Children - you are of an age now when you are presenting yourself to the world your a grown up. Although to be fair you rarely act like one as fun is always on the menu. You're bold, warm, confident and want to be in the spotlight. You're charismatic and generous. You are protective of loved ones and anyone who might threaten them will see you roar. You're very regal, creative, dramatic but you must avoid success making you arrogant. Centre of attention with your sunny disposition but if you're in the shadows the sun can dim and you turn on the drama. You are generous with your time and affections, ambitious and you're happy to take charge when required. An actor springs to mind here as you love the adoration and praise. You have the vitality of the sun and just being around your life giving nature makes people feel alive. If something is wrong you will sit down and get it sorted. 


Virgo - A -second Earth position -  Earth - mutable - Planet Mercury (shares with Gemini) - Musical note F - Intestines - August 23rd to Sept 29th - I analyse - 6th house - Solfeggio 285 or 174 -  I assess data as it comes to me - I examine and review it. I enjoy discussing the results and doing further study if necessary through dialogue and visual assessments. I analyse what is required. I am practical, analytical and meticulous by nature. You embody service to others - symbol a woman holding a sheaf of wheat - bring in that harvest. You have a drive for perfection, a sharp mind, you're a great problem solver and reliable with everything in order. You are rooted in the Earth, accuracy and high standards can mean you tend to criticize others less perfect, your obsessive about things that interest or attract you. You make a good friend and partner and will dedicate yourself to the people in your life. You want to be of service to others and your mind often brings in the harvest of all your hard work. You are a planner, organiser and prefer structure over chaos. A good worker, you have a sense of purity, innocence and you are self sufficient. An innocent happy world full of happy people is all you want from life. Your bright mind can solve any problems that present to you. You can be pernickety and overwhelmed when things do not go well. The state of the world in chaos is not good for you. 


The Sun Sign Qualities of Gemini and Cancer

A closer look at sun signs……

 Gemini  - G - First air/tree position - Air/tree - Planet Mercury (shares with virgo both are mutable) - D musical note - I think - central nervous system - 21st May to 20th June - Solfeggio 528 or 417 - 3rd house - I think - I am pensive in thought - I think once again we combine I am and I think - when engaged in serious thought dreamily thinking in a quiet way - withdrawn as your deep in thought. Gemini is a short journey, siblings, chatter, it can be a short journey through the mind, you're miles away in thought but can be back in the room instantly when you hear a sound. For oft when on my couch I lie in vacant or in pensive mood springs to mind. You can find the bliss of solitude in your own mind and your heart fills with pleasure. Sometimes your mind distracts you like in a school lesson when you are not concentrating, like the symptoms of ADHD. Thinking is time travel anywhere anytime. I am, I have and I think put these thoughts to good use making plans for a bright future. Your energy is that of the teenager. You're adaptable, curious, intelligent, a great communicator. Symbol of the twins you can be in two minds often or present as two different people depending on what is happening. Sociable, funny, versatile, quick witted, able to see many perspectives in a situation. There can be duality and indecisiveness especially if you get bored. You love to learn and can charm your way into any company. You have many interests, being able to see all the angles makes it hard to settle on a particular direction as you need to be stimulated by something or you move on. 


Cancer - C - First water position - Water - Cardinal - Planet Moon - D# Musical note - I feel - Chest area - fourth house - Solfeggio 417 or 396 - 21st June to 22nd, July - I resonate - Je Ressens - Nobody can feel things in the same way that I feel them. A vibration I feel is personal to me alone. What am I feeling, only I know. 4th house - Water - to feel is to sense - sentience is the ability to relate to feelings and sensations. You tune into something and feel it in your body. Once you become aware of feelings consciousness is born. Becoming aware of how much feelings control you is vital if you want to remain a free spirit. The verb Sentir is to feel something. Je sens is to feel but Je ressentir is to feel in an abstract manner not involved with actual senses but something else, intangible like love. Je ressens due bonheur, I feel happiness, I feel love, joy etc., your emotions are working well. The Moon affects the tides so you may feel highly emotional one day and not so much the next. Overwhelmed by emotion and then the tide turns. The womb and feminine energy are a work here. So now I am a spiritual being and I love myself, I can think for myself and I will gain control over my emotions. Cancer seeks true emotions which can be abstract and intangible. You are of an age when you start thinking about leaving home and thats a very emotional experience. Caring, intuitive, protective, emotional, mother, behave like crabs can be known to take a sideways step if required as they don’t like to find themselves in the thick of things. You have a hard outer shell to protect yourself and your sensitivity but the inner you is the homemaker and family and home are the most important things to you. Moons constantly changing as do your emotions for you family is your religion. You make devoted parents and want peace in the home. You can tune into the feelings of others and mistake them for your own so be on guard for that. You can live on land and in the sea you need personal space from time to time to process how and why you might be feeling a certain way. Beware mood swings. You are reserved, cautious and need time to open up to someone. You set boundaries for your own good as you can be intense and not even be sure these feelings are yours. Hyper sensitivity is at work here. 


The Sun Sign Qualities of Aries and Taurus

closer look at our birth signs….

Aries - T - First Fire position - Cardinal - Planet Mars - (shares with scorpio) Middle C on piano - I am - Head - Solfeggio 741 or 639 - 1st House - 21st March - 19th April - I am Je Suis Jesus - when you say I am Jesus with confidence you identify yourself with God a self declaration of who you are. No longer who am I but I am. I am The Way - Yahwet - I am a daughter, sister, Mother, friend, wife and so on. Only when you can say I am God and then all of the roles you play are for the greater good of others does it begin to feel real.   Pioneer, adventurer or fool who takes chances. You have nothing to prove once you are The Way, take those chances and learn from them. Ich bin…….I Ching……(g becomes b)…….everything starts from the fire of conception -  Lots of red energy but will you be busy and active or a war monger fighting. Mars can present in different ways. You're like a newborn you have seen nothing before and want to have a go at everything. A leader by nature you are full of energy, assertive, competitive, passionate and whilst you love to start new things you can become bored easily and not see them through to the end. You are more a fan of new and exciting. Symbol Ram which butts heads quite often so be aware of that, being fearless and direct you can come over as self absorbed be aware of that too. As you are easily distracted from Aries to Pisces seems a long way off and you get pulled away from what your doing failing to reach the end result. You can have a short fuse and your fiery temper could be your downfall. Stick with the excitement of life and you won't go far wrong. 


Taurus - A - First Earth position - Earth - Planet Venus Fixed version (shares with Libra cardinal)  C# musical note - I have - Solfeggio 689 or 528 - 2nd house - I have - J’aime - j’taime - my reason d'être - 20th April to 20th May - Neck - You have experienced I am now it’s I have. I am rich or I have wealth. We have learned to see ourselves as part of God now we need to learn to say I love myself. I have good self esteem. Don’t measure your wealth materially but by how much you love yourself if you want to be enlightened. You see yourself as love - I am love - Je Suis l’amour - we are back to sharing with Aries I am. When you can say I love - j’aime - I can love both you and me and when I can say I love you - je t'aime - I can love myself for who I am and not what I have. I love myself Je m’aime and I love you as God would expect. Don’t be distracted by diamonds and pearls. You have the energy of a toddler now so don’t stamp those Bull hooves too strongly. You are grounded now and down to Earth, loyal, stubborn and a lover of beauty, luxury and comfort. Venus is the planet of beauty and love it is sensual and connected to physical attractions. Art, food and music are your things and once you start a project you are determined to see it through to the end. Stable and reliable though resistant to change or new situations. You are materially connected to the world and manifesting what is required to give you this life of luxury which is what you are all about. You work hard to achieve your goals and make a good friend, loyal and trusting. You can be head strong and fixed in your ways not keen to be persuaded to do something differently. You prefer predictability over chaos every time. You love beauty, money, pleasure but avoid over indulgence or you will end up on a merry go round of working, buying etc., Learn to be a little more flexible and try not to hold grudges. 


3rd, October, 2025 Soloman’s Temple Game of 34

The Other One of the Pair....

Here we have the small game of Solomans Temple this can produce ALL 64 codons of DNA within its pattern provided you turn the game over and see the other missing codons. Imagine it is placed on glass and you can see it from the top and from underneath then you could make all 64 codons of DNA out of this pattern.

Now if I want to add the missing codons to this particular pattern and see all the codons on top of the pattern then I would have to find a way in to add more triangles but if you look at this pattern X marks the points where you cannot add anything without reproducing a codon that already exists. Take the top left hand side we have green A blue C and G Yellow on the top row. If we added any other triangle to the C position it would create codons that can already be found in the pattern. The only way to increase the pattern is to remove a triangle and start from there. 


This image shows both sides of a 16 pattern if only I could get the pattern to work together and create a game of Soloman’s Temple with just 32 pieces but unfortunately I have played constantly without success and 34 is currently the minimum amount of triangles I can use to create a pattern that shows all 64 codons. 

I feel that if 16 completes half then 32 should be possible to complete the whole. I will keep trying but until I succeed here is another game of 34 the best I have achieved so far. 


This is a completed game of 34 parts showing gold dots are places where triangles can be added if they were required and the X shows points where nothing can be added without creating more than one of a codon. 

Enjoy your thinking and I will continue to try to reduce this game. It took me 12 years of happily playing the game having reduced it to 36 and once a game of 34 was produced of course I now try to reduce to 32 and it may take me another 12 years but at least no matter how difficult it used to be to make 34 I now find that count easy so time will tell. X 





Tuesday, 23 September 2025

The I Ching and the Number 5

 

Here we see the I Chiing if we added in the extra rows marked in red for the number fives.  The green or wooden cross contains the Tree/Air elements…….yellow is all Earth, Lilac is all Metal and the combinations contain both……..the blue lines denote the fire and water elements of the chart. 

So as we know number five has a habit of being nothingness or invisible…..


So we still have the appearances but the red cross at centre is now clear it simply does not exist. Is the five within? 

Enjoy your thinking x 

The Number 5 in Nine Star Ki and The I Ching

 

In the I Ching based on 2814976 we have four quadrants top left C Water - Top right T Fire

The bottom left hand side A Earth - bottom right hand side G Air/Tree……here we take a closer look at the top left hand quadrant of Water Cytosine.

Each of the 16 sections contains a dominant or centre number from a Bagua. So CCC DNA Codon 2/2 Nine star ki gets the ball rolling. 2/2 is at the centre of the Bagua and when a double number is at the centre ALL of the numbers become doubles. So a powerful Bagua indeed associated with the Grand Trine in Water. All double numbers in an I Ching map move from the left to right in a diagonal line. So we see the four double number Baguas here are 2/2 - 8/8 - 1/1 - 4/4. The number 5’s in these Baguas are removed leaving just 8 Nine Star Ki numbers in the Bagua. All of the 5 numbers removed in a centre pack are 5/5.

The red oblong shape denotes the numbers that will be changed into double numbers for example 2/8 at the centre changes its 8/5 into 2/2……2/1 at centre changes its 6/5 to a 4/4 and so on. The green cross shows the excluded square that is now empty. 

In this section of The I Ching NE/SW and SW/NE seems to dominate here. 

So any number 5 in a Bagua is amended to read and alternative number if 5 is the first or year number it is cancelled out altogether but the 5 in the month or second number will change it to a double number. 

Lets look at the first 5 and second 5 and compare it to the double number…….

Centre number 22 first and second are 5 and 5.

52 cancelled    85 - 22 **

54                    55 - 44

57                    35 - 77 **

58                   25 - 88 **

Centre number 88 first and second are 5 and 5

 51                    95 - 11

56                    45 - 66

53                    75 - 33 **

Centre number 11 first and second are 5 and 5 

59                    15 - 99

Centre number 44 and second and first are 5 and 5


So lets take an example of a Bagua with 5/7 cancelled…..

So the North East corner is missing and the North West corner has been changed from 35 to 77…

My own 1/7 Nine Star ki is as follows…….


Solfeggio number 5’s will need change too I wonder if the Gregorian Monks realised that the number 5 does not exist in The I Ching……….and yet 5’s in solfeggio balance our DNA beautifully….. perhaps they had to change and adapt too. Enjoy your thinking x 

Monday, 22 September 2025

The I Ching and DNA Codons relationship with the Number Five

 


Here we have the directions map - 8 sections N/S - NE/SW - E/W - SE/NW - all 8 directions each containing numbers 1 to 9 ………………….the image at the top shows which Nine Star Ki fits into which section. Double numbers have been placed at the centre of each of the Baguas….you will notice there are no number fives here. The number 5’s appear to match with a single number and doubling it. For example 1/5 becomes 9/9 ……9 being the opposite to number 1……… so each number with a 5 becomes a double number which always sits at the centre of the lower edge of the bottom map. 

Note also how each of the sections in the Bagua have a missing portion ……again the numbers contain that five and thus are not required. Each Bagua would have number 5 appear twice and each time they are either removed or cancelled out and the other one becomes part of the double number. The five that is the month number is associated with the double numbers and the one that has 5 as the year number is removed altogether.

So the 9 sections of 9 that we usually know = 81 parts but the middle section of 9 is missing here and one from each of the other 8 panels is missing so…..

    81 - 9 - 8 = 64 DNA Codons or I Ching Hexagrams. 

The missing numbers from each of the 9 boxes above are as follows….

                       6/5            1/5            8/5

                       7/5            —            3/5

                       2/5           9/5           4/5

In the I Ching and with DNA Codons none are made from the number 5 but in Solfeggio music the number 5 is present ……..birthdates can create number 5 years and months and when they do they will need to be changed to either an 8 or a number 2. The nine Baguas also contain the number 5 twice in each section I give below an example of my own……

                                                                    96            52            74

                                                                    85            17            39

                                                                    41            63            28

 

We would look at this bagua as 5/2 in the South position would be removed and the 8/5 position would be amended to read 8/2 that way each number appears twice but number 5 does not appear at all. 

8/5 has no I Ching Hexagram but 8/2 can now become Hexagram 15 which also has a North East sitting South West Facing direction. DNA Codon CCA. 

Obviously you need to check each variation on the five as it may become 8 or 2 depending on the count.

Imagine North South 1/1 and 9/9 and notice they have numbers opposite to each other as each falls into the centre they cancel each other out. 

More work to be done here but I have long wondered about the purpose of the number five. Enjoy your thinking. X 


Sunday, 21 September 2025

DNA Codons - Nine Star Ki Directions

 



Each section of this direction map has nine star ki numbers 8 times…….there is no mention of the number 5 in this map or indeed in The I Ching. 

North and South go together as do 1 and 9 lets see what other patterns we can find between all the numbers…..

North/South 1 & 9…from outer to centre…

ATG    9.4 interestingly the start point being North and it begins with Methionine or MET the Start Button…..and its pairing is the STOP button TAG. So does everything begin in the outer north position and end there once more. 

ATG            9/4        4/9        TAG - STOP and Start Met ATG

TCA            8/3        3/8        ACT

AAC           7/2        2/7        TTC

AGA           6/1        1/6        TGT

No. 5           5/9        9/5        No 5

CAG           4/8        8/4        CTG

GTC            3/7        7/3        GAC

TTT             2/6        6/2        AAA

No. 5           1/5        5/1        No.5

GCG           9/9        1/1        CGC

So observations here are that the number five positions contain the numbers 1 and 9 and they become the double numbers at the centre of the map. They do not appear as fives but as 1 or 9 in this case. The nine star ki that sit in the North and face South are to the left hand side and the Nine Star Ki that sit in the South and face North are to the right. As they flow into the centre of this map they cancel each other out. This is so often the case in The I Ching at the end of the day there is nothing to see because everything has been cancelled out. 

North East/ South West 2 & 8…from outer to centre…

GTG            9/6        6/9        GAG

No.5            8/5        5/8        No.5

AGT            7/4        4/7        TGA * STOP

GAA            6/3        3/6        GTT

No.5            5/2        2/5        No.5

CGA            4/1        1/4        CGT

GCT            3/9        9/3        GCA

CCT            2/8        8/2        CCA

TGC            1/7        7/1        AGC

CCC            2/2        8/8        CCG

The same patterns apply here the number 5’s are associated with the double numbers 2 and 8. The thing about this one we can see that in nine star ki an 8/5 and 5/8 will become and 8/8 and the 2/5 and 5/2 will become 2/2 this is useful information in the Bagua when we come up against number 5 and are not sure if it will become a 2 or an 8 in this case we know. 

East/West 3 & 7… from outer to centre…

ACA            9/2        2/9        TCT

CTA            8/1        1/8         CAT

GAT            7/9        9/7         GTA

AAG           6/8        8/6        TTG

No.5            5/7         7/5        No.5

TGG            4/6        6/4        AGG

No.5            3/5        5/3        No.5

CTT            2/4        4/2        CAA

TAC            1/3        3/1        ATC

GGC           7/7        3/3         GCC

The number 5’s here are connected to 7 and 3 but we cannot determine whether 5’s would become 2 or 8 maybe we should just accept them as becoming part of the double numbers. So in a Bagua 5/7 would become 7/7 etc.,

South East/North West …from outer to centre…

ATA            9/1        1/9        TAT

TCG            8/9        9/8        ACG

AAT            7/8        8/7        TTA

GGA            6/7        7/6        GGT

No.5            5/6        6/5        No.5

No.5            4/5        5/4        No.5

ATT            3/4        4/3        TAA - STOP

TCC            2/3        3/2        ACC

CAC            1/2        2/1        CTC

GGG            6/6        4/4        CGG

Again the number fives only connect to 6 and 4 or the double numbers. 

Lets look more closely at the numbers 1 and 9 North and South…..


This gives us a closer look at the codons that move North East to South West and South West to North East…

We place the middle number at the centre in this case 2/5 made into a 2/2 and 8/5 made into an 8/8. Each of the 12 months of the year are represented and the decision to change the fives into either 8 or 2 is made in order to make sure all months are represented. So we see how the centre numbers with their placement of number 5 determines that five is indeed the centre. The five will be changed into either 2 or 8. 

I will return to this with proper maps for each set of directions and pairs of numbers. Enjoy your thinking. X






Saturday, 20 September 2025

Solfeggio and Nine Star Ki I Ching Connections


 I cannot help but see the I Ching 28143976 across the top and down the sides as though the year number e.g. 1 Water Blue floats by in a horizontal way and the month numbers vertical line floats by to make the negatives picture much clearer…….my own 1/7 is third row down Blue 1 water and 7th row down in the vertical…….creating a red vertical line for the month and a blue dot at the centre for the year number. 

In Solfeggio music the Month number also seems to be the dominant……

Feb/Nov born    8 5 2

Mar/Dec            7 4 1

April/Jan           6 3 9

May                  5 2 8

June                  4 1 7 

July                   3 9 6

August              2 8 5

Sept                  1 7 4

Oct                   9 6 3

Early dates of each month can vary and belong to the month before but the majority work to this rule. 

So my 1/7 Nine Star Ki is now represented as a vertical red line with a dot of blue in it alternatively it could be a blue horizontal line with a red dot in it or a cross where both vertical and horizontal cross over. My Solfeggio for those born in March is 741…….all about communication and the throat chakra. There is so much more to us that just our date of birth can tell us. Enjoy your thinking. X 

Monday, 15 September 2025

The 64 Bagues and Their Directions and relationsbip to number 5

 

Here we see the Directions Map of Nine Star Ki and The DNA Codons of The I Ching. I am focussing on my own 1/7 Bagua to show how all codons and Nine Star Ki in any Bagua will ALL take the same direction as the centre code. 

96 - GTG     52 - X         74 - AGT

85 - X          17 - TGC     39 - GCT       All of these Nine Star Ki sit in the North East and Face South West

41 - CGA    63 - GAA    28 - CCT 

If you look to the marked section above all of these codes are in this same section. Starting on the outer edge with GTG. The codes that contain number 5 do not appear 5/2 becomes 2/2 CCC and 8/5 can only become 8/2 which does not appear in this section. CCA 8/2 appears in the opposite side of South West. 2/8 appears in the S.W. Side as 5/8 but shows in the North East side. So perhaps those 5’s are happier in their opposite position. 

So all 64 codons can appear at the centre of a Bagua and then all the other Nine Star Ki will face the same direction as the centre partnership. 64 codons 8 in each of the 8 sections. 

Enjoy your thinking. X 

Sunday, 14 September 2025

One Moment in Time Read differently and in Many Ways

 The Aspect shapes that can be found in my birthchart based on the letters in DNA Codons……



Not all shapes in your chart can make a DNA Codon they have to have a planet in Aries, Taurus, Gemini or Cancer as a starting letter. The second letter will be found in Leo, Virgo, Libra and Scorpio and finally the third letter would be found in the signs Sagittarius, Capricorn, Aquarius and Pisces. 


So for me that creates the following triangles as follows…


TTT - Grand Trine in Fire - 120 x 120 x 120 -  Phenylalanine - Hex 12 - Directions North to South - 6/6 - 2/2 Crystal - Musical Notes - C E G# - Planets Saturn and Venus - Nine Star Ki 2/6 - 

Hydrophobic


TTC - Thinker - 120 x 150 x 30 - Phenylalanine - Hex 45 - Direction South to North - Double Crystal - Musical Notes

C E B - Saturn Venus - Nine Star Ki 2/7 - Hydrophobic


GTT - Alternator - 60 x 120 x 180 - Valine - Hex 25 - Direction South West to North East - Double Crystal - Musical Notes D E G# - Jupiter Venus - Nine Star Ki 3/6 - Hydrophobic 


GTC - Teacher - 60 x 150 x 90 - Valine - Hex 17 - Direction North to South - Diamond Crystal - Musical Notes D E B - Jupiter Venus - Nine Star Ki 3/7 - Hydrophobic 


GGT - Alternator - 120 x 60 x 180 - Glycine - Hex 10 - Direction North West to South East - Double Crystal - Musical notes D F# G# - Venus Venus - Nine Star Ki 7/6 -  Neutral 


GGC - Lecturer - 120 x 150 x 90 - Glycine - Hex 58 - Central direction - Double Crystal - Musical Notes D F# B - Venus Venus - Nine Star Ki 7/7 - Neutral 


CTT - Thinker - 30 x 120 x 150 - Leucine - Hex 20 - Direction East to West - 6/6 - 2/2 Crystal - Musical Notes D# E G# - Saturn Jupiter - Nine Star Ki 2/4 - Hydrophobic 


CTC - Thinker - 30 x 150 x 20 - Leucine - Hex 8 - Direction North West to South East - 8/4 - 7/3 Crystal - Musical Notes D# E B -  Nine Star Ki 2/1 - Hydrophobic 


Four of them are Number 2 Nine Star Ki……….2 are Nine Star Ki 3…..2 are Nine Star Ki 7 …….

2 3 7

Aspect Shapes 1 x Grand Trine - 3 x Thinker - 2 x Alternator - 1 x Teacher - 1 x Lecturer 


2 x Phenylalanine - 2 x Valine - 2 x Glycine - 2 x Leucine 


Directions….. South to North  

North to South x 2

     South West to North East 

North West to South East  x 2

Central 

East to West 


Crystals 6/6 - 2/2 x 2

Double x 4

Diamond x 1

8/4 - 7/3 x 1


Musical notes ….. C D D# E F# G# B……


Missing notes…..       C# F G A A#…..


Planets Saturn - Venus - Jupiter 


Hydrophobic x 6 - Neutral x 2


TTTTTCGTTGTCGGTGGCCTTCTC…………..Hmmmmm I wonder what I can create from that little lot. The Grand Trine in Fire is much appreciated I get some time to relax at least. Perhaps I can be creative in inspirational ways. Three Thinkers wel I guess this blog explains that to be the case……two Alternators busy or lazy depending on my mood……….and finally the three tone Lecturer which when combined three colours Red, Blue and Green create white light……so big lessons to learn from here but stay in the light and all will work out well. 


So I will go off and throw some shapes today and hope they come together and create something wonderful. Enjoy your thinkiing. X