Details for the 1/1 - 9/9 Crystal of The I Ching and DNA Codons

Here we see the 1/1 - 9/9 Crystal of The I Ching Hexagrams showing the DNA Codon that matches with and also the Nine Star Ki Numbers.  

SEQUENCE FOR DNA CODONS T to G to A to C to T………. 

Working out a crystal is easy bottom line GCG next line takes the last two letters or colours and adds another to the end. So here we start with GCG then move on to CG - A the A comes from  moving onto the next letter A. Then we have CGA - copy G A and add T you have the next codon GAT. GAT moves onto ATA and so on……..until once you have made 12 codons the list ends and then repeats itself. So this is the correct positioning of a 1/1 - 9/9 Crystal. 

Notice also each codon has a Hexagram number and each of them has a partner we see how they sit together is this next image….

We see here that GCG partners with CGC Hexagrams 29/30 make a pair. The same rules apply for all of them each has a partner. Sometimes there are anomalies but in the 1/1 crystal there are none and they all conform to the rules. 

There are 6 different crystals of The I Ching DNA 3 of them contain 12 codons, one has a double connection therefore 24 codons, another has 12 but partners with a small crystal of only 4. With this particular crystal we have nine of each of the elements T Fire, G Air, A Earth and C Water.  A nice balance. 

The Aspect shape of each of the codons is shown on the left 4 Workers, 180 x 90 x 90 variations, 4 Ruminators 180 x 150 x 30 variations, 4 Lecturers 120 x 150 x 90 variations. 

Amino acids are shown down the left hand side some repeat but mostly they don’t. The arrow is showing you which direction this Nine Star Ki takes for example the top two are South and South West. Etc., 

The planets associated with each codon are also shown I like to think my TGC Mercury and Venus is a beautiful mind focussed on beauty. 

The house position when drawn in a circle is also shown my TGC being placed in the 3rd house of communication. Finally the musical notes they make are shown on the left hand side.

So what can you tell me about my own TGC DNA Codon, 1/7 Nine Star Ki, moved from North East to South West, Ruminator 180 x 150 x 30, Amino Acid Cysteine, Planet associations Mercury and Venus, positions in the third house of communications, musical notes C F# B.

There is doubless many many more things I can connect to this one position in a 12 part crystal but this will be enough for one day. Enjoy your thinking. X 

Elements in The I Ching 28143976

 If you lay out The Word of The I Ching in the form of 28143976 you get four sections of elements. Top left hand side we start with C Water.

C is the first letter of a codon made up of the letters creating DNA. All DNA Codons beginning with C belong to the water - blue element. C is Musically D# it has connections to the planets Saturn, Mercury and Jupiter. It connects us to the astrological sign Cancer a 4th house position. So this is the IC position in a chart the Cardinal point associated with Water. C denotes Cytosine. Amino acids that can be produced through C water are Proline, Leucine, Histidine, Arginine and Glutamine. The aspect shapes that can be made in water are Grand Trine in Water, Thinker, Alternator, Lecturer, Ruminator, Teacher and Magician. The only missing aspect shape is The Worker or all red aspect shape. Note this position is musically D# and the higher note of its opposite G which is D. C and G go together in DNA. 

G is the first letter of a codon made up of the letters creating DNA. All DNA Codons beginning with G belong to the Air/Tree Yellow Element. G is Musically D and it has connections to the planets Jupiter, Venus and Mars. It connects astrologically to the sign Gemini and the 3rd House position. A Mutable house and sign position. G denotes Guanine. Amino acids that can be produced through G Air are Alanine, Valine, Glycine, Aspartic Acid, Glutamic Acid. The aspect shapes that can be made in Air are Grand Trine in Air, Lecturer, Ruminator, Teacher, Alternator, Worker and Magician. There are no Thinker aspects here. The Thinker is a blue and green aspect shape. Note this position is musically D and the flatter version of its opposite C which is D#. G and C go together in DNA. 

T is the first letter of a codon made up of the letters creating DNA. All DNA Codons beginning with T belong to the Fire - Orange element. T is musically C and it has connections to the planets Saturn, Mercury, Venus, Mars, Jupiter in fact all of them. It connects astrologically to the sign Aries and the first house AC position. A Cardinal house known as the Ascendant. T denotes Thymine. Amino acids that can be produced by T Fire are Serine, Phenylalanine, Leucine, Tyrosine, Cysteine and Tryptophan. The aspect shapes that can be made in T Fire are Grand Trine in Fire, Alternator, Lecturer, Magician, Ruminator, Worker, Thinker and Teacher. All aspect shapes can be found here. Note this position is musically C the flatter version of its opposite A which is C#. T and A go together in DNA.  

A is the first letter of a codon made up of the letters creating DNA. All DNA codons beginning with A belong to the Earth - Green element. A is musically C# and it has connections to the planets Saturn, Mercury, Jupiter, Venus and Mars. It connects astrologically to the sign Taurus and the 2nd Fixed house. A denotes Adenine. Amino acids that can be produced A Earth are 309, Isoleucine, Lysine, MET - Start, Asparagine and Serine. The aspect shapes that can be made in A Earth are the Grand Trine in Earth, Lecturer, Worker, Magician, Alternator, Ruminator and Teacher. There are no Thinkers in this section a Blue and Green shape. Note this position is musically C# the sharper version of its opposite T which is C. A and T go together in DNA.

It’s understandable that only C and T contain Thinkers as they appear on the top line only of The I Ching pattern for The Word. Workers do not appear in the C Water section perhaps because they contain only red lines and blue is a more peaceful shade. 

Its interesting to see what is in each section but also what is not in each section. Enjoy your thinking. X 

The Four Elements and their Relationships

 

Here we see the twin hearts of The I Ching based on 28143976.

At the top left we have Water Blue first musical note is D# for all DNA Codons that begin with C - CAC for example……8 different aspect shapes can be found here so ALL of them are available in Water. Amino acids we have 5 types in Water…..Proline x 4, Leucine x 4, Histidine x 2, Arginine x 4 and Glutamine x 2.

Top right we have Fire Orange first musical note is C for all DNA Codons that begin with T e.g. TAT… again all 8 aspect shapes can be found here all available in Fire. Amino acids we have 7 different types in Fire….. STOP x 3, Serine x 4, Tryptophan x 1, Phenylalanine x 2, Leucine x 2, Cysteine x 2 and Tyrosine x 2. 

Bottom right we have Air (also tree) Yellow first musical note is D for all DNA Codons that begin with G e.g.  GAG. Only 7 aspect shapes can be found here there are no Thinkers shapes. Amino acids Alanine x 4, Valine x 4, Aspartic Acid x 2, Glycine x 4 and Glutamic Acid x 2. 

Bottom left we have Earth Green first musical note is C# for all DNA Codons beginning with A e.g. AGA. Only 7 aspect shapes can be found here as once again their are no Thinker Shapes but all others are here. Amino Acids Threonine x 4, Isoleucine x 3, Methionine x 1, Lysine x 2, Arginine x 2 and Serine x 2.

Note how Amino Acid Leucine appears in C Water but also T Fire. Arginine appears in C Water and A Earth. Serine appears in T Fire but also A Earth. Shared positions here but showing that same name amino acids does not mean same qualities. 

It is clear why C and T have only 7 aspect shapes because Thinkers are associated with the number and therefore only appear at the top of the I Ching chart. 

T and A are connected in DNA and both have 7 choices of amino acids.

C and G are connected in DNA and both have only 5 choices of amino acids. 

Enjoy your thinking. X 

Amino Acids which are the same but translate differently in The I Ching

We have here the I Ching - The Word - based on 28143976 showing the positions and other information regarding amino acids. We can see that more than one of each is presented for example,  1/7 and 1/6 both create the amino acid Cysteine. Now I have been saying for some time that its all well and good saying they both create cysteine but it is clear to me they have different qualities and potentially functions. Maybe one version being created would need TGC and another TGT…….both would create cysteine in different ways.

Nine Star Ki 1/7 - DNA Codon TGC - facing South West - Hydrophobic - Cysteine - Hexagram 47 - 1/1-9/9 crystal - Fire Quadrant - Musical notes C F# B - planets Mercury Venus - aspect shape Ruminator 180 x 150 x 30.

Nine Star Ki 1/6 - DNA Codon TGT - faces North - Hydrophobic - Cysteine - Hexagram 6 - 8/4 7/3 crystal - Musical notes C F# G# - Planets Mercury Venus - Aspect shape Alternator 180 x 60 x 120. 

So what do they both have in common - hydrophobic - Cysteine - two musical notes C and F# - Planets Mercury and Venus - first two letters of the DNA Codon TG - each of them start their nine star ki with number 1 water - both are in the fire section of the I Ching.

I have always thought they must have differences if something is the same amino acid then everything about it should be the same and it isn’t and I read this article this morning that says . . . .

Human DNA sequences are built from four nucleotides (TGAC) making three letter codons….each codon tells the cell which amino acid to use when building a protein. Since several codons can create the same amino acid they were thought to be interchangeable. That view has changed scientists now know that some of these synonymous codons help RNA remain stable and get translated efficiently whilst others do not. So two genetic sequences can encode for the same protein but still behave differently inside a cell. 

Now to me one look at this amino acid chart and it tells you that’s obvious…… 1/7 is not 1/6 and GGA is not GGG and C F# B is not C F#G# and so on……….so glad to hear they have realised that but unless all markers are the same they can have great similarities culminating in producing the same amino acid but it does not mean one amino acid e.g. TGC is not better used with situation A whereas amino acid TGT could well be better served in situation B. Variations on a theme always tells you so much more. 

So great news to realise I have been on the right track for so much longer. Enjoy your thinking. X 

One Moment in Time Read differently and in Many Ways

 The Aspect shapes that can be found in my birthchart based on the letters in DNA Codons……

Not all shapes in your chart can make a DNA Codon they have to have a planet in Aries, Taurus, Gemini or Cancer as a starting letter. The second letter will be found in Leo, Virgo, Libra and Scorpio and finally the third letter would be found in the signs Sagittarius, Capricorn, Aquarius and Pisces. 

So for me that creates the following triangles as follows…

TTT - Grand Trine in Fire - 120 x 120 x 120 -  Phenylalanine - Hex 12 - Directions North to South - 6/6 - 2/2 Crystal - Musical Notes - C E G# - Planets Saturn and Venus - Nine Star Ki 2/6 - 

Hydrophobic

TTC - Thinker - 120 x 150 x 30 - Phenylalanine - Hex 45 - Direction South to North - Double Crystal - Musical Notes

C E B - Saturn Venus - Nine Star Ki 2/7 - Hydrophobic

GTT - Alternator - 60 x 120 x 180 - Valine - Hex 25 - Direction South West to North East - Double Crystal - Musical Notes D E G# - Jupiter Venus - Nine Star Ki 3/6 - Hydrophobic 

GTC - Teacher - 60 x 150 x 90 - Valine - Hex 17 - Direction North to South - Diamond Crystal - Musical Notes D E B - Jupiter Venus - Nine Star Ki 3/7 - Hydrophobic 

GGT - Alternator - 120 x 60 x 180 - Glycine - Hex 10 - Direction North West to South East - Double Crystal - Musical notes D F# G# - Venus Venus - Nine Star Ki 7/6 -  Neutral 

GGC - Lecturer - 120 x 150 x 90 - Glycine - Hex 58 - Central direction - Double Crystal - Musical Notes D F# B - Venus Venus - Nine Star Ki 7/7 - Neutral 

CTT - Thinker - 30 x 120 x 150 - Leucine - Hex 20 - Direction East to West - 6/6 - 2/2 Crystal - Musical Notes D# E G# - Saturn Jupiter - Nine Star Ki 2/4 - Hydrophobic 

CTC - Thinker - 30 x 150 x 20 - Leucine - Hex 8 - Direction North West to South East - 8/4 - 7/3 Crystal - Musical Notes D# E B -  Nine Star Ki 2/1 - Hydrophobic 

Four of them are Number 2 Nine Star Ki……….2 are Nine Star Ki 3…..2 are Nine Star Ki 7 …….

2 3 7

Aspect Shapes 1 x Grand Trine - 3 x Thinker - 2 x Alternator - 1 x Teacher - 1 x Lecturer 

2 x Phenylalanine - 2 x Valine - 2 x Glycine - 2 x Leucine 

Directions….. South to North  

North to South x 2

     South West to North East 

North West to South East  x 2

Central 

East to West 

Crystals 6/6 - 2/2 x 2

Double x 4

Diamond x 1

8/4 - 7/3 x 1

Musical notes ….. C D D# E F# G# B……

Missing notes…..       C# F G A A#…..

Planets Saturn - Venus - Jupiter 

Hydrophobic x 6 - Neutral x 2

TTTTTCGTTGTCGGTGGCCTTCTC…………..Hmmmmm I wonder what I can create from that little lot. The Grand Trine in Fire is much appreciated I get some time to relax at least. Perhaps I can be creative in inspirational ways. Three Thinkers wel I guess this blog explains that to be the case……two Alternators busy or lazy depending on my mood……….and finally the three tone Lecturer which when combined three colours Red, Blue and Green create white light……so big lessons to learn from here but stay in the light and all will work out well. 

So I will go off and throw some shapes today and hope they come together and create something wonderful. Enjoy your thinkiing. X 

A Closer Look at the Amino Acids Codons for Isoleucine

 Another variation on a theme of Amino Acids lets take a closer look at Isoleucine…..

Isoleucine Amino Acids….

ATC  -  Earth Fire Water - 3/1  -  Air/Tree and Water - Hydrophobic - Hex 3 - Double Crystal - Music C# E B - Direction W/E - Planets Jupiter & Mercury - Aspect Shape Teacher - 90* x 150* x 60*…..

ATT - Earth Fire Fire - 3/4  Air/Tree and Air/Tree- Hydrophobic - Hex 42 - Double Crystal - Music C# E G# - Direction SE/NW - Planets Jupiter and Jupiter - Aspect shape Lecturers - 90* x 120* x 150*…..

ATA - Earth Fire Earth - 9/1 Fire and Water - Hydrophobic but also Neutral so can adapt if required  - Hex 63 - 1/1 Crystal -  Music C# E A - Direction SE/NW - Planets Mars & Mercury - Aspect shape Lecturer - 90* x 150* x 120*…..

Between them all we can produce Fire, Earth, Air and Water though individually they present differently. Codons all contain Earth and Fire with only ATC producing water. ATC and ATT are both hydrophobic but ATA is able to be both Hydrophobic and Neutral producing Hydrophilic if required. The Hexagram numbers appear in the beginning, middle and end of the I Ching numbers. We have two in the Double crystal and one in the 1/1 crystal. We have two Lecturers and only one Teacher shape. That said all three of them are producing red, blue and green aspect lines. Predominantly Jupiter, seconded by Mercury with only one using Mars. Directions two of them SE/NW and one W/E so perhaps they can all click to the W/E horizontal line if required. So many similarities and many differences but all of them creating the amino acid IsoLeucine. 

Patterns in the map show sitting below ATT is ATG 9/4 MET or start button….Hydrophobic - Hex 37 - direction N/S - music C# E A# - Planets Mars/Jupiter - Worker 90* x 180* x 90*…….They are distinct amino acids with different chemical structures and roles in biological systems. While some studies have explored substituting methionine for isoleucine in specific protein locations, this is a mutation-based manipulation, not a natural metabolic conversion.  

….. but of course not Isoleucine itself just sitting alongside the Isoleucine in another form of patterning. 

So many variations on the theme of Isoleucine that makes me think there has to be a reason for having 

the choices to make. Enjoy your thinking. X 

Amino Acids and their Repetitions does that make them Redundant?

Here we have a map of Amino Acids with their Aspect shapes………lets take a closer look at the amino acids ……

Cysteine there are just two cysteine amino acid codons. Why does DNA bother to have to codons for one amino acid. There can only be one answer they have the same name but are slightly different in their approach to whats required of them. 

Cysteine Nine Star Ki 1/7…….Water and Metal energies - Codon T G C Fire Air and Water - Directions positioned in the North East facing South West….. creates a Ruminator Shape of Red and Green lines - 

Hydrophobic - 1/1 - 9/9 Crystal - Hexagram I Ching 47 - Musically C F# B - Planets Mercury and Venus - 180* x 150* x 30* 

Cysteine Nine Star Ki 1/6….. Water and Metal energies - Codon TGT Fire Air and Fire - Directions positioned in South facing North ….. creates an Alternator Shape of Red and Blue lines - Hydrophobic - 8/4 - 7/3 Crystal - Hexagram I Ching 6 - Musically C F# G# - Planets Mercury Venus - 180* x 60* x 120* 

So here we see that although they both make Cysteine they are not the same properties that make that Cysteine, I have no clue if that makes a difference but common sense tells me that something is different about these two amino acids but nevertheless they get lumped together. They are both hydrophobic so prefer to be on the inside of a DNA Ladder so thats a shame had they been hydrophobic and hydrophilic that would make sense. So they are the same in this respect.

Nine star ki is similar but slightly different both are water and metal numbers but one is the Autumn number 7 and the other the approaching winter number 6. As we know 6 and 7 are both metal but have very different ways of being 7 is more about fun and wealth, children and insurances, number 6 is more orderly and rock solid, upholding the law, religion, Leadership. So slight variations here. They each belong to a different I Ching crystal but that is understandable and 6 doesn’t appear in the 1/1 crystal and 1 doesn’t appear in the 6/6 crystal. 

CODONS - TGC and TGT TGC has Fire, Air and Water……..fire needs air for support but if it gets out of hand Water will step in and dowse those flames. TGT on the other hand is more fiery without the control button Water might offer. Directions TGC is NE/SW and TGT is S/N……..now I learned something interesting today that vertical and horizontal waves flow nicely but if a diagonal wave comes it has to decide what it wants to be vertical or horizontal and it will click into place and the diagonal line is gone. Now thats about all I know about that but it does give us the possibility here that TGC may click S/N and NE/SW will be a distant memory so although they are not the same they could well become the same. 

They create different aspect shapes TGC The Ruminator all red and green in shape and TGT The Alternator all Blue and red in shape. Without a doubt they will operate differently because of it. Red and green more stressed energy that gets things done and the red and blue which is busy one minute lazy the next. 

Hex 47 and Hex 6 if you read up on them are they very different in their ways of working I have to imagine so as 6 is the early sections of the I Ching numbers and 47 is much further along.

Musically TGC if C F# B and TGT is C F# G#………..first to notes are the same but TGC plays the higher note B and TGT lowers the tone by 3 half tones. They are not singing the same tune. 

They both operate with the same planets Mercury and Venus….Mercury for the Water Number 1 energy and Venus for both 6 and 7 Metal energies. 

So we have 64 codons in total but only 20 amino acids are made from them. The information in the three nucleotide letters contain information or data that tells us what they are. Some say many codons are now redundant but I find that hard to believe unless we are indeed turning into robots that need less of them. Amino acids may have more than one variation on the theme of cysteine as we have here but that would not make them redundant. So we conclude they are the same but different and we should be cautious of that. 

Enjoy your thinkiing. X 

More Facts on The Word 64 Hexagrams

 Hex  DNA Nine ⭐️Shape Music     A.Acid Dir

1 GGG 6-6  Trine             DF#A#   Glycine Centre

2 CCC 2-2  Trine                 D#GB   Proline Centre

3 ATC         3-1 Tch                 C#EB   Isoleucine W/E 

4 CAT         1-8  Tch                 D#FG#   Histidine W/E

5 AGA 6-1 Lec                 C#F#A        Arginine N/S

6 TGT         1-6 Alt         CF#G#       Cysteine S/N

7 CAC 1-2 Alt         D#FB         Histidine SE/NW

8 CTC         2-1 Thk                 D#EB         Leucine         NW/SE

9 AGG 6-4 Lec                 C#F#A#     Arginine     W/E

10 GGT 7-6  Alt         DF#G#       Glycine         NW/SE

11 AAA         6-2  Trine                 C#FA   Lysine         S/N

12 TTT         2-6  Trine                 CEG#   Phenylal N/S

13 GTG 9-6  Alt         DEA#   Valine         NE/SW

14 GAG 6-9  Lec                 DFA#   Glut Acid SW/NE

15 CCA 8-2 Alt         D#GA   Proline         SW/NE

16 TCC         2-3 Thk                 CGB   Serine         SE/NW

17 GTC 3-7 Tch                 DEB           Valine         N/S

18 CAG 4-8 Mag                 D#FA#    Glutamine N/S

19 AAC         7-2 Alt         C#FB   Asparagine N/S

20 CTT         2-4 Thk                 D#EG#       Leucine         E/W

21 GCT 3-9 Rum                 DGG#   Alanine         NE/SW

22 ACG 9-8 Wrk                 C#GA#       Threonine NW/SE

23 CCT         2-8 Thk                 D#GG#       Proline         NE/SW

24 ACC 3-2 Alt         C#GB   Threonine NW/SE

25 GTT         3-6 Alt          DEG#   Valine         SW/NE

26 AAG 6-8 Lec                 C#FA#   Lysine         E/W

27 ACT* 3-8 Rum                 C#GG#   Threonine         S/N  

28 TGA* 4-7 Wrk                 CF#A     STOP Opal SW/NE

29 CGC 1-1 Lec                 D#F#B     Arginine Centre

30 GCG 9-9 Lec                 DGA#     Alanine Centre

31 TTA         8-7 Lec                 CEA             Leucine NW/SE

32 TAA         4-3 Lec                 CFA             STOP Ochre NW/SE

    

33 TTG         8-6 Alt         CEA#   Leucine W/E

34 GAA 6-3 Lec                 DFA           Glut Acid NE/SW

35 TCT     2-9 Thk                 CGG#   Serine         W/E

36 ACA         9-2 Alt         C#GA   Threonine E/W

37 ATG         9-4 Wrk                 C#EA#   MET -start N/S

38 GAT         7-9 Wrk                 DFG#   Aspartic Ac E/W

39 CTA         8-1 Rum                 D#EA   Leucine E/W

40 TAC         1-3 Rum                 CFB           Tyrosine E/W

41 AAT         7-8 Lec                 C#FG#    Asparagine SE/NW

42 ATT         3-4 Lec                 C#EG#    Isoleucine   SE/NW

43 GGA 6-7 Lec                 DF#A     Glycine SW/NE

44 TGG 4-6 Alt         CF#A#     Tryptophan  E/W

45 TTC         2-7 Thk                 CEB            Phenylal  S/N

46 CAA         4-2 Alt         D#FA     Glutamine W/E

47 TGC 1-7 Rum                 CF#B     Cysteine NE/SW

48 CGA 4-1 Wrk                 D#F#A     Arginine NE/SW

49 GTA         9-7 Mag                 DEA             Valine         W/E

50 TAG         4-9 Mag                 CFA#     STOP Amber S/N

51 GCC* 3-3 Lec                 DGB     Alanine Centre

52 CCG* 8-8 Lec                 D#GA#        Proline         Centre    

53 CTG 8-4 Rum                 D#EA#     Leucine S/N

54 GAC 7-3 Wrk                 DFB             Aspartic Ac S/N

55 GCA 9-3 Mag                 DGA   Alanine SW/NE

56 TCG 8-9 Tch                 CGA#   Serine SE/NW

57 CGG* 4-4 Lec                 D#F#A#      Arginine Centre

58 GGC* 7-7 Lec                 DF#B   Glycine         Centre

59 CGT 1-4 Tch                 D#F#G#      Arginine SW/NE

60 AGC 7-1 Mag                 C#F#B     Serine         SW/NE    

61 AGT* 7-4 Mag                 C#F#G#      Serine         NE/SW

62 TCA* 8-3 Tch                 CGA     Serine         N/S

63 ATA         9-1 Lec                 C#EA   Isoleucine SE/NW

64 TAT         1-9 Lec                 CFG#   Tyrosine NW/SE

Those marked * are Alerts as they do not conform but share tops with each other. 

There are 8 shapes of DNA Codons as they match with the Hexagrams and Nine Star Ki. . . 

Grand Trine - Teacher - Lecturer - Alternator - Thinker - Magician - Worker - Ruminator.

Each Hexagram has a sitting and facing direction e.g. NW/SE would be sitting in the NW facing SE 

So we have the Hexagram number and its partner…..DNA Codon letters…. Nine Star Ki numbers…. Musical notes….

Amino Acid and Direction. 

Most are self explanatory but with the nine star ki numbers not how they can swop into each other….

1 2 3 4

5

9 6 8 7

Each pair will match diagonally as the same or the opposite in this little grid above except ALERTS associated with T and A 

if the alerts that don't match swapped the top hat portion back to the original they would match but they don’t so hence they are called alerts they just will not do as they are told. 

When it comes to shapes we see they can match when the same e.g. Trine with Trine……we also see pairings of Lecturer/Alternator…..Alternator/Thinker…..Teacher/Magician….. Ruminator and worker. 

You can see that most can attach as they have a line in their shape that is the same as the partner and can click together there but Trine/Trine, Teacher/Teacher and fine…..Lec/Alt have a 120* line they can connect with….Rumincator and Worker can connect on the 180* angle….Teach and Magician can connect via the 60* line…..but the Alternator and Thinker do not seem a good fit.

Alternator 180* x 60* x 120* - Thinker 150* x 30* x 120*….. and yet there are 6 pairs that partner with Alternator and Thinker. It may mean nothing but I like to observe when things don’t conform. 

Note how musically Hex 1 and 2 have the following….

D F# A#

D# G B each note raised ½ (up1.5)

47-48

C F# B

D# F# A

Up 1.5 - same - up 1 note (up 2.5)

In each of these case the codon that sits on top has raised its tone. You can check above if that is the case with your own Nine Star Ki. Sadly for me as a 47 I appear to be lowering the tone. Hmm. Or perhaps I dont shout and have a more gentle way. 

Various amino acids partnering each other again many variations here. 

Finally the directions all the double numbers are centred perhaps as in previous maps they are turned inward as when a double number is in the centre of a nine star ki map all the energy is turned inward. Some hexagrams are going in the same direction as their partner. Some in the opposite direction to their partner and finally 15 of them are going in completely different directions. They give me the most cause for concern as patterns go but not for any other reason. 

So I think this is enough to keep you busy today. Enjoy your thinking. X