One Moment in Time Read differently and in Many Ways

 The Aspect shapes that can be found in my birthchart based on the letters in DNA Codons……

Not all shapes in your chart can make a DNA Codon they have to have a planet in Aries, Taurus, Gemini or Cancer as a starting letter. The second letter will be found in Leo, Virgo, Libra and Scorpio and finally the third letter would be found in the signs Sagittarius, Capricorn, Aquarius and Pisces. 

So for me that creates the following triangles as follows…

TTT - Grand Trine in Fire - 120 x 120 x 120 -  Phenylalanine - Hex 12 - Directions North to South - 6/6 - 2/2 Crystal - Musical Notes - C E G# - Planets Saturn and Venus - Nine Star Ki 2/6 - 

Hydrophobic

TTC - Thinker - 120 x 150 x 30 - Phenylalanine - Hex 45 - Direction South to North - Double Crystal - Musical Notes

C E B - Saturn Venus - Nine Star Ki 2/7 - Hydrophobic

GTT - Alternator - 60 x 120 x 180 - Valine - Hex 25 - Direction South West to North East - Double Crystal - Musical Notes D E G# - Jupiter Venus - Nine Star Ki 3/6 - Hydrophobic 

GTC - Teacher - 60 x 150 x 90 - Valine - Hex 17 - Direction North to South - Diamond Crystal - Musical Notes D E B - Jupiter Venus - Nine Star Ki 3/7 - Hydrophobic 

GGT - Alternator - 120 x 60 x 180 - Glycine - Hex 10 - Direction North West to South East - Double Crystal - Musical notes D F# G# - Venus Venus - Nine Star Ki 7/6 -  Neutral 

GGC - Lecturer - 120 x 150 x 90 - Glycine - Hex 58 - Central direction - Double Crystal - Musical Notes D F# B - Venus Venus - Nine Star Ki 7/7 - Neutral 

CTT - Thinker - 30 x 120 x 150 - Leucine - Hex 20 - Direction East to West - 6/6 - 2/2 Crystal - Musical Notes D# E G# - Saturn Jupiter - Nine Star Ki 2/4 - Hydrophobic 

CTC - Thinker - 30 x 150 x 20 - Leucine - Hex 8 - Direction North West to South East - 8/4 - 7/3 Crystal - Musical Notes D# E B -  Nine Star Ki 2/1 - Hydrophobic 

Four of them are Number 2 Nine Star Ki……….2 are Nine Star Ki 3…..2 are Nine Star Ki 7 …….

2 3 7

Aspect Shapes 1 x Grand Trine - 3 x Thinker - 2 x Alternator - 1 x Teacher - 1 x Lecturer 

2 x Phenylalanine - 2 x Valine - 2 x Glycine - 2 x Leucine 

Directions….. South to North  

North to South x 2

     South West to North East 

North West to South East  x 2

Central 

East to West 

Crystals 6/6 - 2/2 x 2

Double x 4

Diamond x 1

8/4 - 7/3 x 1

Musical notes ….. C D D# E F# G# B……

Missing notes…..       C# F G A A#…..

Planets Saturn - Venus - Jupiter 

Hydrophobic x 6 - Neutral x 2

TTTTTCGTTGTCGGTGGCCTTCTC…………..Hmmmmm I wonder what I can create from that little lot. The Grand Trine in Fire is much appreciated I get some time to relax at least. Perhaps I can be creative in inspirational ways. Three Thinkers wel I guess this blog explains that to be the case……two Alternators busy or lazy depending on my mood……….and finally the three tone Lecturer which when combined three colours Red, Blue and Green create white light……so big lessons to learn from here but stay in the light and all will work out well. 

So I will go off and throw some shapes today and hope they come together and create something wonderful. Enjoy your thinkiing. X 

Soloman’s Temple and Attempts to reduce it to 32 Triangles

 Here we see two sets of the game The Other One of the Pair………..both contain 16 triangles one is the under reading of the other so all 64 codons of DNA appear between them, or with just one set if you set them up on glass and could read the underside.  I presumed that the game Solomans Temple which I have only managed to create in 34 triangles at the last count could be joined together and perhaps create a game of 32 for Solomans Temple. As you can see it looks simple enough to find a way in to connect without creating a duplication but no I have yet to find it. 

Here we see both sets that together give us 64 codons of DNA the gold lines denote areas where if you add a triangle it will duplicate itself so thats a no no. The purple dots are where you could add a new triangle but not without duplicating again. So as you can see there is no way in to join the pair so the only thing you can do is remove a triangle and try to reconnect them that way. So far I have failed and it still seems it is impossible to create a Soloman’s Temple game with less than 34 triangles. That said I remember for years thinking Soloman’s Temple could not be made up of less than 36 triangles.  So I will continue to try.

The I Ching is The One which becomes 2 then 4, 8, 16, 32 and 64 so in my mind I do not feel happy to settle on the number 34 being the least amount of triangles needed to create Soloman’s Temple of 64 codons, somehow its just not the right number to associate with DNA. So I will keep trying, wish me luck. 

Finally I have an answer and the game is only possible in 34 triangles. No lower count would work. X 

The 6/6 - 2/2 Crystal Expanded Jupiterian Style and Reduced Saturnian Style

 As we look to the top image this is forming the DNA I Ching Crystal with its peaks at 6/6 and 2/2.

6/6 starts the crystals as it is Hexagram number 1. GGG three yellow air/tree triangles the next one along is created by taking the last two letters of the first Hexagram GG and then turning one step clockwise on the wheel of CTGA…

Using this format you can turn clockwise C to T - T to G - G to A - A to C or anticlockwise when dealing with RNA but that doesn’t apply here in the crystals. 

So GGG moves to make GG then the first G Yellow moves on one spot to Green A and creates the next Hexagram in the crystal GGA - then GGA becomes GAA and so on until you reach twelve codons at the top which is TGG. It ends there because TGG would only start over again creating GGG, 

So the top image shows how the crystal was created….it is the simplest of the crystals to work with as it is so uniform. 

The bottom image shows you those 36 triangles but this time instead of as a ladder climbing as a straight line of 36. This is described as Jupiterian size expanded. Then we move to the middle image which is described as Saturnian because it is reduced to its smallest without losing the ability to stretch it out once more. 

The secret to the reduction is start with the first Codon/Hexagram GGG we know the next one is GGA… so we presume the second GG and remove it and put only the A. The then next one is GAA so we have the GA from the previous codon so just add the next A creating GGG AAA and so on to the end. 

I guess if you need to save space on data this is a good way to do it. Jupiter is like breathing in and expanding and Saturn is breathing out and reducing. We can see without doubt this is the easiest Crystal to work with and the patterns are less complex. 

The same rules can be followed with the 6/6 crystal the 1/1, the 8/4 the Double and the Diamond.

Enjoy your thinking x 

Soloman’s Temple and The Other One of the Pair and their DNA Codons

 

…..example of 34 triangles making up the game Soloman’s Temple……

Example of 17 triangles making up a game of The Other One of The Pair…

More Data please or is that enough for one day x 

The Record of Life in DNA Codons showing house positions

 

Here we have The Record of Life which shows each of the 64 codons of DNA In their house position. The bottom picture includes all elements and starts in the East with Green A Earth then C Blue Water, T orange Fire and G Yellow Air/tree. Everything has its place………my own TGC is in the 3rd house of communications. As you go up the images you get the single colours and how they appear, Blue Water, T Fire, G Tree/air and A Earth.

Above them you see the combinations with their complimentary opposites of partners T with A and G with C………..enjoy your thinking. X 

The Patterns within The Years Numbers in Nine Star Ki

Here we see the Nine Star Ki Year Numbers each number shows ALL the DNA Codons present in any one year. 

Number 1…contains Ruminator, Teacher, Lecturer, Worker, Alternator - 5 shapes

Number 2…..Dominated by a Grand Trine in Water and another in Fire, Lecturer, Thinker - 3 shapes 

Number 3 … Ruminator, Lecturer, Teacher, Worker, Alternator - 5 shapes

Number 4 … Ruminator, Worker, Lecturer, Teacher. Alternator - 5 shapes

Number 6 … Grand Trine in Earth, Lecturer, Magician, Ruminator, Teacher, Alternator, Thinker - 7 

Number 7… Worker, Magician, Teacher, Lecturer, Ruminator, Thinker, Alternator - 7 shapes

Number 8… Teacher, Ruminator, Lecturer, Worker, Alternator - 5 shapes

Number 9… Lecturer, Magician, Ruminator, Teacher, Worker, Alternator, Thinker - 7 shapes

So 1 and 9 12 shapes - 2 and 6 10 shapes - 3 and 4 10 shapes - 7 and 8 12 shapes.

Now your probably thinking there are more shapes in there and thats true but they do not conform to the pattern required to make a DNA Codons. The first letter of a codon needs to be in the 1st of four the second letter needs to be in the 2nd of four and the third letter in the last four positions. 

That said those shapes are still in there and perhaps assist in the creation of other things but not DNA Codons. 2 and 6 are the only numbers to contain Grand Trines.

Grand Trines are only available to numbers 2 and 6

Thinkers to 2,6,7 and 9

Lecturers to 1,2,3,4,6,7,8,9 or all numbers

Ruminators to 1,3,4,,,6,7,8,9 just missing the number 2 

Magicians to 6,7 and 9

Teachers to 1,3,4,,,,,6,7,8,9, just missing the number 2 

Workers to 1,3,4,,,,,7,8,9 missing number 2 and 6

Alternator to 1,3,4,6,7,8,9 just missing number 2 

Lecturers share with all the numbers and Grand Trines with the least. 

Interestingly numbers 1,3,8 share a double Ruminator and 9,4 and 7 share a double Worker with 2 and 6 sharing Grand Trines and as we know Moonlight is made from 6,1,8 and 3. Sunlight is made up from 4,9,2 and 7……so each group can utilise the Grand Trine when they need to. 

That is enough for one day for you to absorb enjoy your thinking. X 

The Shapes and Numbers of Nine Star Ki and DNA Codons

 Again we see the map of shapes etc., but below find the Sun and Moon differences of Aspect Shapes.

The image above shows the aspect shapes that appear in the numbers 4,9,2 and 7 associated with the Sun. We have The Grand Trine, The Alternator and Lecturer, which appears in both Sun and Moon shapes.Then we have the Thinker aspect. The Magician, The Worker.  So six of the 8 aspect shapes of DNA are associated with the workings of the Sun.

This image above shows the aspect shapes that appear in the numbers 6, 1, 8 and 3 associated with the Moon. We have the Grand Trine, Alternator and Lecturer as we do with the Sun also but we also have The Ruminator and The Teacher. So only 5 aspect shapes are associated with the Moon.

Grand Trine 120* x 120* x 120*    ALL BLUE       4            360* blue                                    Total 360

Alternator 180* x 120* x 60*        Red, Blue, Blue 12          180* red, 180* blue                    Total 360

Lecturer 150* x 120* x 90*           Red, Blue, Green  18      90* red, 120* blue 150* green   Total 360

Thinker 150* x 120* x 30*            Blue, Blue, Green  6       Blue 120*, Green 180*              Total 300*       

Worker 180* x 90* x 90*              ALL RED         6             Red  360*                                   Total 360

Magician 150* x 150* x 60*        Green, Green, Blue   6    Green 300*, Blue 60*                 Total 360

Ruminator 180* x 150* x 30*      Red, Green, Green  6      Red 180*, Green 180*                Total 360

Teacher 60* x 90* x 150*             Red, Blue, Green    6      Red 90*, Blue 60*, Green 150*  Total 300*

Note that 6 of the aspect shapes create a triangle with 360* around its outside but 2 of them only create 300* aspect shapes they are definitely the smallest of the aspect shapes The Teacher is in The Moon section and The Thinker is in the Sun section so once again all seems to equalise. These two shapes cover less are that the other 6. 

In total if we add together all the blues, reds and greens we would have from all 64 codons the following measurements……

Blue In total 5040 degrees of triangle…………green and red both 7560 degrees of triangles.

So there is always a measure of 5040 in blue aspects and one and a half times more of green and red at 7560 …..so red and green are much more prevalent than blue. They are busier too whereas we tend to relax a bit more in the blue aspects. 

My own Ruminator TGC 1/7 is green and red without any blue for relaxation…….go figure lol. I am sure that I can borrow some blue in the Moon aspects as we can all work together. 

Enjoy your thinking. X 

DNA Codons and I Ching codons in Comparison

 

Top right hand side shows the partnership of codons within The I Ching Hexagrams…..starts with GGG over CCC Hex 1 and 2…then follows 3/4 and so on moving up each row at a time until reaching the top of row four for codon Hexagram 64 You will see they partner with each other as hexagrams within the crystals of The I Ching 

The DNA Codons are at the bottom left of the image and it shows how they change when partnering with the other one of the pair of DNA Codons starting with Hexagrams 1/2 GGG/CCC but then they move on and change for a Codon. Hexagram 3 ATC partners GAT as they would on a ladder of DNA. They no longer pair with the hexagrams though.

Its almost as though you have to make a crystal I Ching set as they pair up to each other 1/.2, 3/4, 5/6 etc., all the way through to Hex 64. In a DNA Codon they put T with A and C with G and vice versa and this creates the pairing. You could never work this out without first making them pair up in The I Ching. 

Enjoy your thinking. X

The Music of The Spheres in DNA Codons & Nine Star Ki Hexagrams 11, 12 pairings

If music be the food of love play on..........we all have our own tune to play, our own tones and ways of being. The Aspect shapes below show all eight of the shapes that DNA makes which can be moved into 64 different codons depending where on the circle the Chord line is placed. A chord in geometry is a line that moves from one side of the circle to the other in varying degrees of size 30*, 60*, 90*, 120*, 150* and 180*. Let’s take a look at those musical patterns and chords of geometry as they connect to the piano. Hexagrams 11 & 12  are a pair in the crystals but do not pair with another set of codons. 

We see here that Hexagrams 11 & 12 are connected to the planets Venus & Saturn and Nine star ki numbers 6 & 2 and are both Grand Trine aspect shapes Hex 11 produces the Amino Acid Lysine and Hex 12  produces the amino acid Phenylalanine. Earth & Fire  appear here. 

Hexagrams 11 & 12 pair up in the way crystals do A and T change but C and G remain the same if a T or A appear in the codon. With DNA its T becomes A and C becomes G and vice versa in this case they simply become each other. 

The Aspects Shapes and Their Partnerships

We see here the relationships between the 8 shapes or aspect patterns that DNA can make. Top left The Grand Trine with The Lecturer… Top right The Ruminator with The Worker… bottom left The Alternator with the Thinker and bottom right The Teacher with The Magician. Obviously different variations of the shape can pair with other DNA Codons so long as one of the lines matches. So we have the great talent of the Grand Trine pairing with the Lecturer……..such talent is University level learning so long as you use that red energy to get things done. Talent wasted because it comes easy is such a waste. The Ruminator spends a lot of time in contemplation before working something out and all that hard work finally pays off. Then we have the Thinker with The Alternator I wonder if these people are often in two minds, they might think hard on something only to switch paths at the last minute and think something else, perhaps thinking is their down time and working hard is their alternative way of being reaching their goals in the end. Finally we have the Teacher and The Magician and we all have a Teacher in mind who was like a magician to us they made learning fun so we wanted to learn and it was never a hardship. Middle school level of thinking with a Magician for a Teacher means you can on to that University degree in the end. Notice how some combinations bring in an extra element to the mix TGC - TGA have all four elements at work here.   I guess learning is what life is all about. Enjoy your thinking this weekend. X  

DNA Codons in The Record of Life showing the pairings

 

The top image is of The Record of Life which shows the position in a circle of all 64 codons of DNA. The other images the second one for example just shows the positions of C Water and G Air/Tree as they are complimentary opposites and we can see that from this image that they reflect each other. The others show just one letter C Water - T Fire - A Earth - G Air/tree as stand alone colours. The bottom one once again shows T and A as a complimentary pairing and again they reflect each other.

When working with DNA patterns it is so easy to see if you made a mistake because the image will show you something is wrong. It is so easy to make a mistake though so its not surprising our DNA codes wrongly as often as it does. I am sure it is not intentional. Lol. Enjoy your thinking. X 

Your Sheng Chi and Best Directions

 This is a Map of DNA Codons and their sitting positions from the perspective of direction. My own TGC for example is found in the North East position facing inwards towards the centre and South West. The double numbers 4/4 - 7/7 etc., they are made up from only the letters G or C Yellow or blue and are always found closest to the centre. Imagine yourself on a carousel ride how much faster it seems to spin the further you are from the centre. T Orange G Air/tree C Water are spread out across the map horizontally so for me it has G yellow at the centre reading TGC from right to left and the second one in from the centre with only CCC 2/2 in front of it before reaching the centre. So not a bad ride I might think. 

Our sitting positions (North East) and your facing positions (South West) denote you facing your Sheng Chi or best position so for me sitting in the North East and facing South West wherever possible is the best thing for me. Your front can determine whether or not that is easy for you. For example for me North is at the front centre of my house leaving the corners to be secondary directions so I would need to put things on an angle if I wanted to be using my Sheng Chi to full advantage. Something worth thinking about when you buy a house is it good for your Sheng Chi. Enjoy you life however you face it. X 

Perfect Elements in DNA Soloman’s Temple

 

Here we see one of the codons has been highlighted in the mix of 36 triangles 9 of each element. This shows us the Hexagram 47 TGC but also the Hexagram 59 CGT………so there may be 64 codons in total but in repeating patterns we find we can reduce all 64 codons into a pattern of just 36 triangles. X

Nine Star Ki and DNA Codons

In 9 Star ki……….

Number 1 can only begin with C or T

Number 2 can only  begin with C or T

Number 3 can only begin with A or G

Number 4 can only begin with C or T

Number 5 becomes a number 2 and can only begin with C or T

Number 6 can only begin with A or G

Number 7 can only begin with A or G

Number 8 can only begin with C or T

Number 9 can only begin with A or G 

So C or T x 5 and A or G x 4

So all DNA codons beginning with C or T must have the first nine star ki number of 1, 2, 4, 5 or 8

All DNA Codons beginning with A or G start with a nine star ki number of 3, 6, 7 or 9 

Lets take my own DNA Codon of TGC it starts with T so it must be a 1,2,4 or 8…..therefore it must be in the T section of the I Ching map to the top left. Second letter G is still in this T section but the quarter of the T that is G which is the bottom right hand corner of the Fire Quadrant……..this is the position in the fire quadrant for the number 7 and 4 then we have a C which means the C is in the G quadrant but in the C section of it which is the top left hand side of the G section. Which now makes it a 7……so TGC is Nine Star Ki of 1/7. TGC is Fire Air and Water.

We start with 4 sections choose one in this case T Orange then we have 4 sections within the T section and then we have 4 sections within the G which gives us TGC 1/7 x

Any random DNA Codon can be worked out this way x

Years 5 and 6 Paired up and Their Potential in Nine Star Ki and The I Ching

 

Lets take a look at two years in a sequence……2021 a 6 year and 2022 a 5 year.

Note that the notes in a 6 year are Earth and Air/tree energies associated with DNA Codon letters A and G.

Note that the notes in a 5 year are Fire and Water energies associated with DNA Codon letters C and T.

Could this then make it possible that we play the left hand or base clef on the piano the A and G notes below ground and the C and T notes above ground are played with the right hand or treble clef.

Just a thought note also the number 5 year amends to read the number 2 which is the top line of the I Ching based on 28143976 and contains four grand trines and 8 thinkers all remaining on that top line.

Then we have the number 6 year which is the bottom line of The I Ching 28143976 and contains once again 4 grand trines but this time its 8 Lecturers all remaining on that bottom line. 

The number 5 - 2 has a balance of 18 Fire and 18 Water letters C or T but all above ground and the 6 year contains a dominance of water with 21 water letters and only 15 Tree/air letters but all below ground. 

Grand Trines give these years time for grand standing also for thinking things through and learn big lessons from it all……..

Musically they pair up as…

Year    5    C    D#    E    G    G#   B

Year    6    C#    D    F    F#   A    A#

                 +      -      +    -     +     -    

Sequence first plus half a tone then - half a tone and so on but all cancelling each other out.

Up down up down up down…………..even and balanced….

No matter how complicated something appears it often ends up being very simplistic indeed x 

Enjoy your thinking. X 

Thoughts on Astrology - I Ching - DNA - Nine Star Ki

There are times when I look at astrology and think it’s simply divine and then others when I think what complete and utter nonsense. Thats usually when trying to make predictions (hides the word idiot) or when you want to tell someone who they are and what they will be which is nonsense as everything in life is fluid and what you might experience at one age you may never experience again so how can it be in any way controlling your way of life. That said all great people like Isaac Newton, Einstein, Copernicus and so on even Stephen Hawking I bet …..have looked at astrology and made some sort of discovery. For me I started with a circle divided into 12 sections. Those sections were divided into four different elements and then they were also divided into three qualities Cardinal, Fixed and Mutable. So 12 - 3 and 4 are prominent numbers for the division of an astrology chart. The letters of DNA are made up of four letters from which you make 3 choices and this creates a DNA Codon. 12 DNA Codons make a crystal of The I Ching so we have gone from studying astrology to studying DNA and the human being. Both get you there but finding patterns within patterns interests me more than prediction or character assessment or assassination. That hasn’t stopped me making up the Who am I Codons of Hexagrams and DNA from Hexagram 1 to Hexagram 64 which gives some form of insight into the nature of a DNA Codon or Nine Star Ki numbers. For example being born in Spring will make you different from someone born in Autumn………take 1/7 Nine Star Ki is DNA Codon TGC and they are born in spring but the same codes will apply to a 1/7 born in December………so very different in some ways but the same in others. All codes and data are for making things up like a recipe and yes they will both be 1/7 TGC but one will be full of the joys of spring and the other looking into the darkness of winter ahead………one has reaped the harvest and has seeds a plenty to plant out for Spring. If the harvest doesn’t come in then spring may not be so full of joy. So many ways the same thing can be changed.  Using your date of birth is just one way of creating your who am I……other ways are dice throwing…………dominoes………throwing sticks…….. flicking a coin…..all will give a result. For example the I Ching is perfect when you have a question so lets make the question am I talking sense……. I will now randomly throw my Rosalind Franklin 50p coin to determine six choices of heads (full Jang line) or tails (Broken Jin line)……I promise you I will be honest…

Tails…tails…heads…tails…tails…tails……

So Broken - Broken - Solid - Broken - Broken - Broken…….this creates Nine Star Ki of  8/2 and DNA Codon CCA Hexagram 15 it sits in the SW facing North East - Amino Acid Proline - Double Crystal - D# G A - Saturn Saturn - 120* x 60* x 180* The Alternator Aspect shape. - Hydrophobic

Hexagram 15 Temperance… Integrity, Modesty, a symbol of humility, moderation, yielding and being humble.  Modesty is needed in your attitude,  allow yourself to be led without resistance. A humble person is thought of as having an open mind without prejudice. Only a person who understands the Tao can know when to stop or disregard what they have and appear as though they have nothing. 

That makes sense to me there are times when working on Who am I codes that I have had to appear as though I have nothing because it is the better choice to make.  There is one particular code that makes me shiver a little and when I come across those who have wronged others they have had these numbers and fit perfectly the scenario being painted. It makes me question whether we can change or are we born into a certain set of circumstances and then we can begin to change and adapt them throughout our lives. Nothing is beyond change so even the more difficult starting points can do something about it. 

The Alternator.......a dynamo that generates an alternative choice or current.e.g. Petrol or diesel - gas or electricity – medicine or homeopathy. Or having an alternative view in order to avoid litigation rather than remaining fixed. One of two possibilities are always available here.........they can take turns but they only get two choices and may slip from one to the other when feeling indecisive.

Musically D# G A creates The Alternator shape and 8/2 is on the left hand Pillar of the balanced and harmonious music of the spheres.  Both planets are Saturn so there is much to learn here and a responsible attitude must prevail this is important work. CCA is hydrophobic so the letters prefer to appear on the inside of a DNA Strand. 

Learning the very most you can about yourself is the key to good astrology and learning how life works in its many patterns can lead to break throughs in medicine, science and religion. Just remember to remain humble and learning as much as you can without letting pride in your work ever become more important. 

The Solfeggio frequency 8/2 plays at is 8 5 2 …works for both February and November…

Spiritual Enlightenment - redirects the mind away from overthinking or intrusive thoughts, these thoughts can play a role in depression and anxiety. Psychological ailments can be helped with this sound vibration. Musical therapy. (852)

Remember you can only create with your thoughts that which you are capable of reaching………DNA Pairs are said to be a form of language so those thoughts must be able to influence our DNA as it send messages to itself and then reshapes a situation accordingly.

Be positive whenever possible because you attract ……..and if your having dark thoughts you can expect to attract something that will feed on them.

Enjoy your thinking and keep it pure. X