Sunday, 14 September 2025

One Moment in Time Read differently and in Many Ways

 The Aspect shapes that can be found in my birthchart based on the letters in DNA Codons……



Not all shapes in your chart can make a DNA Codon they have to have a planet in Aries, Taurus, Gemini or Cancer as a starting letter. The second letter will be found in Leo, Virgo, Libra and Scorpio and finally the third letter would be found in the signs Sagittarius, Capricorn, Aquarius and Pisces. 


So for me that creates the following triangles as follows…


TTT - Grand Trine in Fire - 120 x 120 x 120 -  Phenylalanine - Hex 12 - Directions North to South - 6/6 - 2/2 Crystal - Musical Notes - C E G# - Planets Saturn and Venus - Nine Star Ki 2/6 - 

Hydrophobic


TTC - Thinker - 120 x 150 x 30 - Phenylalanine - Hex 45 - Direction South to North - Double Crystal - Musical Notes

C E B - Saturn Venus - Nine Star Ki 2/7 - Hydrophobic


GTT - Alternator - 60 x 120 x 180 - Valine - Hex 25 - Direction South West to North East - Double Crystal - Musical Notes D E G# - Jupiter Venus - Nine Star Ki 3/6 - Hydrophobic 


GTC - Teacher - 60 x 150 x 90 - Valine - Hex 17 - Direction North to South - Diamond Crystal - Musical Notes D E B - Jupiter Venus - Nine Star Ki 3/7 - Hydrophobic 


GGT - Alternator - 120 x 60 x 180 - Glycine - Hex 10 - Direction North West to South East - Double Crystal - Musical notes D F# G# - Venus Venus - Nine Star Ki 7/6 -  Neutral 


GGC - Lecturer - 120 x 150 x 90 - Glycine - Hex 58 - Central direction - Double Crystal - Musical Notes D F# B - Venus Venus - Nine Star Ki 7/7 - Neutral 


CTT - Thinker - 30 x 120 x 150 - Leucine - Hex 20 - Direction East to West - 6/6 - 2/2 Crystal - Musical Notes D# E G# - Saturn Jupiter - Nine Star Ki 2/4 - Hydrophobic 


CTC - Thinker - 30 x 150 x 20 - Leucine - Hex 8 - Direction North West to South East - 8/4 - 7/3 Crystal - Musical Notes D# E B -  Nine Star Ki 2/1 - Hydrophobic 


Four of them are Number 2 Nine Star Ki……….2 are Nine Star Ki 3…..2 are Nine Star Ki 7 …….

2 3 7

Aspect Shapes 1 x Grand Trine - 3 x Thinker - 2 x Alternator - 1 x Teacher - 1 x Lecturer 


2 x Phenylalanine - 2 x Valine - 2 x Glycine - 2 x Leucine 


Directions….. South to North  

North to South x 2

     South West to North East 

North West to South East  x 2

Central 

East to West 


Crystals 6/6 - 2/2 x 2

Double x 4

Diamond x 1

8/4 - 7/3 x 1


Musical notes ….. C D D# E F# G# B……


Missing notes…..       C# F G A A#…..


Planets Saturn - Venus - Jupiter 


Hydrophobic x 6 - Neutral x 2


TTTTTCGTTGTCGGTGGCCTTCTC…………..Hmmmmm I wonder what I can create from that little lot. The Grand Trine in Fire is much appreciated I get some time to relax at least. Perhaps I can be creative in inspirational ways. Three Thinkers wel I guess this blog explains that to be the case……two Alternators busy or lazy depending on my mood……….and finally the three tone Lecturer which when combined three colours Red, Blue and Green create white light……so big lessons to learn from here but stay in the light and all will work out well. 


So I will go off and throw some shapes today and hope they come together and create something wonderful. Enjoy your thinkiing. X 


No comments:

Post a Comment