A look at Astrology, Feng Shui, Nine star Ki, I Ching and then finally on to DNA. A look at all of these principles through patterns. These are my thoughts and I can give you no evidence but ask that you accept what you are comfortable with and disregard the rest.
Friday, 13 January 2017
The Cubes or Crucifix's of Nine Star Ki
A nice orderly hash tag or bagua shape of all 9 numbers of Nine Star Ki based on the number 1
being at the centre.............each cross can fold up into a cube shape..........
Then a new time begins as we move into the number 9 at the centre.............blowing in the wind. x
Monday, 9 January 2017
Jupiter expansion and Saturn Restrictions in DNA Crystals
Music of the DNA Codons
Crystals
GCG-CGA-GAT-ATA-TAC-ACG-CGC-GCT-CTA-TAT-ATG-TGC
= 36 Letters in the
DNA Codon of the 1/1 – 9/9 Crystal
…. their musical tones are as follows....
D G A# - D# F# A – D F G# - C# E A –
C F B – C# G A# - D# F# B – D G G# -
D# E A – C F G# - C# E A# - C F# B
This gives us the 36 musical notes
that match the 36 letters of the crystal.
Now let us reduce the 36 to 12 and
produce what we might call the chorus of the
main tune....
GCGATACGCTAT
D
G A# - C# E A – D# F# B – C F G#
So
the first D G A# match then three codons on C# E A matches
then
three more codons on D# F# B is a match and then finally C F G# is
three
more codons on …....this tells us that 36 when reduced to just
12
letters shows only the cardinal points of the crystal.
6/6
– 2/2 Crystal
6/6 – 2/2 crystal in 36 letters....CCC – CCT – CTT – TTT – TTG-
TGG- GGG – GGA – GAA – AAA - AAC – ACC
D# G B – D# G G# - D# E G# - C E G# - C E A# - C F# A# -
D F# A# - D F# A – D F A – C# F A – C# F B – C# G B
CCCTTTGGGAAA – 6/6 crystal in 12 letters
D#
G B – C E G# - D F# A# - C# F A
Once
again 36 letters reduced to 12 show only the cardinal points of the
Crystal............
So
reductionism or Saturn restricting growth makes sure that the most
important
part of the crystal the cardinal points of North, South, East and
West
are what we play in the chorus.
All
the other crystals work out the same way..........if music be the
food
of
life - play on.
Saturday, 7 January 2017
DNA Codons Jupiterian reduced to Saturnian levels and yet still repeating patterns......
The 6/6 – 2/2 Crystal has 12 codons
making it 36 letters long.....
CCC – CCT – CTT – TTT – TTG-
TGG- GGG – GGA – GAA – AAA – AAC – ACC
Start with CCC you can add CCT over
the end of the codon and get CCCT then CTT
comes next which we can add to the end
again and get CCCTT and so on until you
have reduced the 36 letters of 12
codons to just 12 letters............36 letters could be
expansive like Jupiter and the 12
letters can be reduced like Saturn.
CCCCCTCTTTTTTTGTGGGGGGGAGAAAAAAACACC
= 36
CCCTTTGGGAAACC = 14
CCCTTTGGGAAA = 12
When you coil it around
and attach CCC to AAA all you need are 12 letters
We have to conclude that
for any 12 letters of DNA we read it could be hiding within
it the possibility of 36
letters of DNA.
The same rules apply for
all crystals ….... the diamond crystal which has only
4 codons of 12 letters to
start with works thus....
CAGAGTGTCTCA becomes CAGT
12 letters become just
4
1/1 – 9/9 Crystal is
GCGCGAGATATATACACGCGCGCTCTATATATGTGC
becomes GCGATACGCTAT................
The double crystal and the
8/4 crystal both work to the same principles.
This particular style of showing the crystal shows the sections of three colours for the letters in the
North or 4th house position we start with GCGCGA etc., but when we reduce down to 12 letters
GCGATACGCTAT..........we find they run around the centre section starting as GATACGCTATGC they also run around the middle section and the outer section just repeating themselves over and over
again. The never ending cycle..........
The Directions and I Ching Lines as Quilts
The I Ching with directional lines I have not marked SE to NW just the direction the line takes because eventually it will come back to itself anyway as NW is SE and so on.....
This version is lines only of The Hexagrams three lines for one number...............
Both ideal for quilt patterns think whilst you sleep. x
This version is lines only of The Hexagrams three lines for one number...............
Both ideal for quilt patterns think whilst you sleep. x
Friday, 6 January 2017
The Substance of Life
How do we get in touch with life's riches. Have faith, believe, visualise. Do you have what it takes to be a person of substance? Are you creative for the sake of being creative or are you competitive?
There is no limit to the riches that can be provided for us. A successful business, a plot of land or a property. All that your heart desires can be yours. The white formless substance at the centre of the map above produces the things you imagine in your mind's eye.
If you impress your thoughts onto this formless substance, you can manifest anything you can allow yourself to think about. You can say quite honestly “I caused this to be made”.
See yourself surrounded by beautiful things but be cautious that one man's beauty is another man's nightmare. Make it what you want it to be. If you think 'I never get anything beautiful', then be happy to accept that you are creating a dark and dismal world that lacks beauty. So long as you are happy with your choices who are we to judge.
'I never have money'... So be it, your wish is my command. Your defeatist attitude is not your friend.
There is nothing too big that can't be created by your thoughts. If it is possible to conceive in the mind, it is possible to be manifest on Earth.
You decide at the age of 65 to become a brain surgeon. Think about it, focus your mind... It's not happening is it? You seem to want things that are impossible that you cannot connect with and thus will fail.
Does this sit well with you to fail? If so, then go ahead. Create something doomed to failure if that's what you want to believe of yourself. This formless substance wants you to think big. It yearns to use the pleasure of the imagination we have been blessed with so when we do use this gift with the amount of excitement and enthusiasm it deserves, the manifestation will be equal to the joy put into it.
There is but one intelligence, one formless substance that everything created will come from, why not take a chance on life and let the formless substance come along for the ride. Make your life so interesting you are completely at one with life itself and The Universe.
For this substance is called life, and it fills the gaps in you that need filling. If you don't know what you want that gap will still be filled, it just won't be of your choosing. Have faith and watch your world improve and then be filled with gratitude for all that life has given you. Love Life like nothing else... Create a clear picture of the life you want to lead, then live it.
The stronger your desire the easier it is to create in your life. Take ownership of those dreams now, in the present, as though you have them already and are so grateful for them. Make more of yourself than you were the day before and life will stick around. A substance is a particular kind of matter of which a person or thing is tangible and actually exists, a solid presence, concrete, material actuality. Proteins or DNA are substance. You are part of this thing called Life. Substance forms the solid base in reality. So thought forming in formless substance that is not strong enough can lead to accidents and change, it is not written in stone until it has manifest on Earth. So be aware and do not let your thoughts drift away from the end goal.
Substantia, a being or essence that is MORE.
Be MORE.
Be the person who always gets what they want. If that makes you think spoiled, then you are not going to get what you want but your space/life will be filled with other things not of your choosing.
Formless substance is Life and it desires to be born and will match itself to someone who has desires and ideas that match up. You cannot fail to connect your Hearts desire with The Formless Substances Desire.
Think and ACT.
This thinking 'stuff' from which all things are made, in its original state, permeates, penetrates and fills inter spaces in our Universe. A strong thought in this substance produces that which is imaged by that thought, causing it to manifest.
When it comes you must be ready and accept it. Do a little every day towards your goal. Never act in haste, be sure, increase your faith, gratitude and give strength to your ideas. The best of you is always yet to come because each and every day you become more than you were the day before.
Be the person you want to be until it is manifest. Play the part or give the impression of whatever you are aiming to achieve.
If running your own business is your goal, in doing so you become a catalyst for the substance to reach others by creating jobs and opportunities for people. Encourage your employees to be courageous enough to do all this for themselves as you are not the top of the ladder you are a collective of others who are joining together.
Never fear the competition. You should want for others what you have for yourself. When you become too big for your boots or the biggest fish in the pond you must advance yourself and move up even further. Opportunities will come, be ready for them or stagnate and in standing still you fall back.
This life doesn't have a finishing line and to feel that you have accomplished it all is when you have fallen back into stagnation. Gratitude grows in resonance over the years and can be felt deep within your body, becoming second nature.
Life is what keeps you alive. If you want nothing from life then life will move away from you. Life is everywhere all around you waiting to be manifest but it will be drawn to those who are embracing it.
Nature abhors a vacuum and will bridge any gaps with whatever it has available. Other people's unused ideas perhaps? Then the choices you neglect to follow shrivel and are replaced by other peoples unused ideas.
Make sure you know what you want from the gift of life. Above all feel the joy, enjoy it and remember to be grateful. x
Subscribe to:
Posts (Atom)

