Sequences iin DNA Crystals Musically

 Lets take a look at the number count of DNA letters in a Crystal…….

First up the 6/6 - 2/2 Crystal…..

AAAAACACCCCCCCTCTTTTTTTGTGGGGGGGAGAA

There is a pattern here of 5 - 1 - 1 - 7 - 1 - 1 - 7 - 1 - 1 - 7 - 1 - 1 - 2

We see the pattern 1 - 7 because when you get to the end loop it up to the beginning again and you get 7 1 1 7 1 1 7 1 1 7 1 1……….

Lets look at the 1/1 - 9/9 crystal in the same way and see if we can find a pattern there too….

TATATGTGCGCGCGAGATATATACACGCGCGCTCTA

The sequence here is no two letters the same appear in the sequence…….so its 1 - 1 all the way 36 times. 

The 8/4 - 7/3 crystal next…..

TGAGAGAGAGACACACACACTCTCTCTCTGTGTGTG

Again this runs with a pattern of 1 - 1 x 36 no two letters sit alongside each other. 

Double Left Hand side crystal…

TTCTCGCGGGGTGTATAAAAGAGCGCCCCACATATT

Sequence here is 2 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 -1 - 1- 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1 - 1 - 2……but if you loop them the 2 x 2 become a 4 so the pattern here of 4 - 1 - 1 - 1 - 1 - 1 x 4 = 36

Right hand side…

CAAAATATCTCCCCGCGTGTTTTATAGAGGGGCGCA

Sequence here is 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1…….but if you loop last to first you get the pattern here of 1 - 1 - 1 - 1 - 1 - 4 the opposite to the left hand side above. (36 in total)

Diamond crystal…..

TCACAGAGTGTC……..ONLY 12 parts in the diamond crystal……

Pattern here 1 - 1 all the way……….no two letters sit alongside each other. 

How many more patterns can we find in the DNA I Ching crystals. 

Tap out those beats and get another way of looking at your own particular codon and how you relate to other crystals……Left hand and right hand double crystals work together albeit as one beat then 4 beats compared to 4 beats and 1 beat. 1/1 and 8/4 crystals along with the diamond crystal all work to one beat over and over………but the Heavenly crystal 6/6 works alone to the rhythm of 7 and 1 and 1…….enjoy your thinking. X