A look at Astrology, Feng Shui, Nine star Ki, I Ching and then finally on to DNA. A look at all of these principles through patterns.
These are my thoughts and I can give you no evidence but ask that you accept what you are comfortable with and disregard the rest.
Monday, 30 December 2013
Map 799 Amino Acids and their communications
Good morning I thought I should communicate with you in a DNA manner and thus have left you the following message.
CACGCCCCCCCTTACTAAAACGAATGGTAGTATGAGGCTAGATGA
If you cannot fathom it try Map 14 for a little help. x
No comments:
Post a Comment