Map 921 All Six Crystals in The Circle of Life

This is an image of all six crystals made into circles to form the circle of life. All life itself can be made from the patterns in this circle.

The Outer edge is Heavenly crystal 6/6 - 2/2 second one in is the 1/1 - 9/9 crystal. This is followed by the double crystal and then the 8/4 crystal is closest to the centre piece which is made from the smaller crystal of the Diamond which has only four codons.

Life is more simple than we think x

Map 920 Abstract Positives and Negatives in The I Ching Hexagrams

Map of Positive and Negative Hexagrams

The green cube is a negative that is hemmed in by positives and has no way to connect other than to a positive. All others can connect to their own kind. Can we reach from a positive to a negative and get around the whole board. Start at any position and mark off neg and pos as you go the plan is to mark off all 64 codons. Good Luck. 

Well I certainly didn't manage it, will you. Beginning and end marked with a heart. x  

Map 919 World Cup Finals as a String of DNA

World Cup DNA

Lets take the dates of the World Cup Finals, change them into Nine Star Ki Numbers, then change them into DNA letters, just what kind of string of DNA would be produced as a representative of the World Cup Finals and what could we make from them.?

1930 7/3           1966 7/3           2002 7/4

1934 3/1           1970 3/1           2006 3/9

1938 8/7           1974 8/6           2010 8/6

1942 Wartime  1978 4/4           2014 4/3

1946 Wartime  1982 9/9

1950 (2) 5/6     1986 (2) 5/7

1954 1/3           1990 1/3

1958 6/1           1994 6/9

1962 2/7           1998 2/6

Sometimes the Final is played in June and sometimes in July hence the variations on the theme. Number 5 is represented as male, I don't think anyone will quibble with football being more masculine than feminine.

Then we have the two dates in 1942/6 that are missing for wartime, do we leave them out altogether because those games are not a part of the DNA of World Cup Finals. I would say yes. Potentially you could add two STOP markers, or even 1/1 water plus water as the lightest of coverings or even a portal. Last but not least you could put in the DNA markers for 4/4 and 9/9 as they would have been the dates they were played. As this is a map of actual world cup finals for me I would leave them out all together. There are no gaps in DNA, as far as we know. 

So what do we get as a string of DNA to describe the World Cup Finals.

GACATCTTATTTTACAGATACAGATTCGACATCTTGCGGGCGTTCTACGAGTTTAGTGCTTTGTAA

So what could we make from this DNA. Enjoy the world cup wherever you are in the world and know that we are all a part of the whole. X  

Map 918 Another look at the directions of the Crystals Variations

There is no doubt about it the simplest of the crystals is the 6/6 Crystal and then the 1/1 Crystal

6/6 Crystal – Read left to right CCC, CCT, CTT, TTT

Read right to left TTG, TGG, GGG, GGA, GAA

Read left to right AAA, AAC, ACC

1/1 Crystal read from left to right GCG, CGA, GAT, ATA,

read from right to left TAC, ACG, CGC, GCT, CTA,

read left to right TAT, ATG, TGC

8/4 Crystal read from left to right GAC, ACA, CAC, ACT, CTC,

read from right to left TCT, CTG,TGT, GTG, TGA,

read from left to right GAG, AGA

A change of angle for the 8/4 

Small 3 codon Diamond Crystal read left to right CAG, AGT, GTC, TCA

Double Crystal - 24 Codons read left to right TCC, ATC, AAT, CAA, GCA, GGC, read right to left CGG, TCG, TTC, ATT, CAT, CCA, GCC, AGC, 

AAG, TAA, GTA GGT, AGG, TAG, TTA, GTT, CGT, CCG

Its clearly more difficult for the double crystal to change direction because of its size.

Ending on CCG would be ready to start off again reading right to left TCC.

Clearly there may well be more ways to tie them together direction wise but this batch I would say are the best of the bunch. The direction DNA takes has to be a vital part of what it creates. x

Map 917 The Curves of The Crystals Part two 8/4 Crystal, 6/6 Crystal and Diamond

Map 916 36 Triangles of DNA to make a Life

DNA Map of Life

From just 36 triangles all 64 codons of DNA can be read. In this particular combination there are 9 Fire, 9 Earth, 10 Tree/Air and 8 Water. A perfect balance would be 9 of each but nevertheless this map with its excess of Tree/Air would be able to create everything in life. Could it be that we are

all of us born with our own 36 triangles and some have an excess of one or two elements and they tend to bring more of that life experience to the world. For example this could be someone in the media using Tree/Air energy to communicate verbally, a reporter or writer for example. Someone with an excess in water could be more spiritual etc., So maybe those with 9 of each element are the most balanced and harmonious of us. Lack of judgement of others would be required if we could prove we were just being what we have been given as tools x

Map 915 Four cubes to Make The World

                                                   1                   2                   3                   4                                                 

It takes just four cubes to create all 64 Codons or twin Hexagram cubes of DNA.

The Larger cube shows one side of the cube the smaller cubes shows its opposite side.

So to the left we have cube 1 CCC and GGG using this cube alone and using The Ho Tu or The Word Map of The I Ching which is positioned at 28143976 all of the diagonal hexagrams (8) from top left to bottom right of the map are made from this cube.

The cube to the far right AAA and TTT can make all the codons of DNA(8) from the top right to the bottom left of the map. With these two cubes alone we have created an X across the map making 16 codons.

The second cube to the left above shows CAA below and GTT above and from this cube 24 codons 8 in the Fire quadrant, 4 in the Water quadrant, 4 in Tree/Air and 8 in the Earth quadrant. 

The second cube from the right above shows AGG below and TCC above and from this cube 24 codons 4 in the Fire quadrant, 8 in the Water quadrant, 8 in the Tree/air quadrant and 4 in the Earth quadrant.

The mix of the four cubes shows this pattern below. Again they conform to pattern.

We can see cube one creates a diagonal line top left CCC Earth to bottom right GGG Heaven. 

Cube two creates a pattern that is very strong in Fire and Earth.

Cube three creates a pattern that is very strong in Water and Tree/Air.

Cube four creates a diagonal line top right TTT (Earth and Heaven combination) to bottom left AAA (Heaven and Earth combination). 

So all four cubes are about making patterns of Heaven and Earth in varying degrees. 

Excuse the clarity of the colours in the cubes above as they are casting shadows and making the colours look different.  The colours as are stated in the letters. I have added below the colours opened out as I do not know how to type it as a cube with colours.

Anyone for Ludo?

Map 914 S String of God like Dominoes or A String of DNA

Domino another word for God............another way of expressing DNA codons.

AGACACCCCCTTTAAGCCGTTGGG

How many ways to say I love you x

Map 913 The Cube of DNA and its matching Cube

This is a set of all 64 codons in Hexagram order each pair of hexagrams makes a cube GGG can be seen above and its shadow or rear view is three blue sides for CCC all pairs of hexagrams make up a cube but they also have a matching pair which create the other cube by flipping the original over from left to right and then top to bottom. So only 40 codes are required.

List of Codons and their matching partner, some have no match, some have a matching cube, with just one match of four codons to one cube only. 

1/2 GGG – CCC No other

3/4 CAT – ATC - 39/40 CTA – TAC

5/6 AGA – TGT -  No other

7/8 CAC – CTC       “

9/10 AGG – GGT - 43/44 GGA – TGG

11/12 AAA – TTT -  No other

13/14 GTG – GAG -         “

15/16 CCA – TCC -   24/23 ACC – CCT Reverse Hex

17/18 GTC – CAG -   53/4 CTG – GAC

19/20 AAC - CTT  - 46/45 CAA – TTC Reverse Hex

21/22 GCT – ACG  - 56/55 TCG – GCA Reverse Hex

25/26 GTT – AAG  - 33/34 TTG – GAA

27/28 ACT – TGA  - 62/61 TCA – AGT Reverse Hex

29/30 CGC – GCG  - No other

31/32 TTA – TAA -   42/41 ATT – AAT Reverse Hex

35/36 TCT – ACA -   No other

37/38 ATG – GAT -   49/50 GTA – TAG

47/48 TGC – CGA -   59/60 CGT – AGC

51/52 GCC – CCG  -  Matches itself

57/58 CGG – GGC              “

63/64 ATA – TAT  -   No other 

The 20 cubes required to make the above can also be further reduced so that only four cubes are required. Oh what a simple world. x 

Map 912 The Curves of The Crystals of DNA

Our first example is of the 1/1 - 9/9 Crystal.

The 1/1 – 9/9 Crystal cons

ists of GCG, CGA, GAT, ATA, TAC, ACG, CGC, GCT, CTA, TAT, ATG, TGC.

The higher smaller pattern is uniform in its colours. If you filled in the blanks they would just be straight lines of vertical colour.

The lower bigger pattern swops all T's for A's with C & G remaining the same. C & G would be straight lines of vertical colours but T & A swop over just as they do in the making of the twins of Hexagrams. 

This pattern goes from North to South before it turns inwards and changes the direction of reading again.

So in both cases the bottom half is read left to right and the top half is read right to left.

Lets see what happens if we create the double crystal, does C & G change or is it still T & A.

So does the horizontal remain straight and the verticals curve around themselves. I wonder. x

Map 911 Perfoliate Growth in DNA

Perfoliate growth is when the plant is growing from the centre of the leaf if we look to DNA for the examples of growth from the centre we would be looking at 2/2 CCC, 8/8 CCG, 1/1 CGC, 4/4 CGG, 3/3 GCC, 9/9 GCG, 7/7 GGC AND 6/6 GGG all are DNA that grow around the centre of a direction chart. x

Map 910 Directions map in cubes

This is the Directions of DNA map as cubes but not as regimented they are allowed to be floating towards their destinations it looks them most like a flower this way.  As we know hexagons are cubes at another angle and I think sometimes that cubes are the best way to portray DNA. In the Crystals we have 12 codons which equate to 5 cubes with a front, back and only one top and one bottom are visible. It doesn't mean they aren't there just that in the cube form of DNA we cannot always see what they are.

So if its water your after then look no further than the N.E. If it's fire your after look no further than the West. Water is controlled by Earth and Metal is controlled by fire so maybe they need to keep the elements under control because they have the most of them in those areas. x

Map 919 DNA Directions Map in Hexagons

Different sizes of 64 DNA codons in their usual sitting positions facing inwards to centre or their opposite points.

Map 919 DNA TGC and CGA Expanded in Jupiterian Fashion

As we can see from the Hexagon above the outer edges are read as follows:

Lower TGC – Upper CGA

Six hexagons within a six sided hexagon by the time we reach the centre we read as follows:

Lower ACG – Upper GCA

Now we have four DNA codons.

TGC - 1/7 – Hex 47 Cysteine … CGA – 4/1 – Hex 48 Arginine

ACG – 9/8 – Hex 37 Met Start … GCA – 9/3 – Hex 55 Alanine

9/3 Is in the Double Crystal all others belong to the 1/1 Crystal

1/7 is NE facing SW – 4/1 NE facing SW

9/8 is NW facing SE – 9/3 SW facing NE

Three of them are on the NE/SW axis and one is on the NW/SE axis

9/8 is known as the Start point MET the others create the amino acids, cysteine, arginine and alanine.

As each centre triangle pushes out it creates it opposite element as the Hexagon gets bigger and bigger the outer edge is always the biggest and presumably a more potent quantity of the amino acid is made. The centre piece being 1 x 6 = 6 the second one is 6 x 6 = 36 third 36 x 6 = 216 fourth 6 x 216 = 1296 fifth 1296 x 6 = 7776 and finally sixth 7776 x 6 = 46656

So a triangle at the centre has a value of 1 x 6 but the outer or 6^th ring has a value of 46656, by the time it is due to start again in its 7^th year it is new again hence the 7 year itch equates to complete change.

Map 918 S.W. and N.E. Directions of DNA as a mirror of its DNA and Nine Star Ki

6/9     Hex 14     9/6     Hex 13     Pair of Hexagrams

4/7             28     7/4             61

3/6             25     6/3             34

1/4             59     4/1             48

9/3             55     3/9             21

8/2             15     2/8             23

7/1             60     1/7             47

8/8             52     2/2               2     Alert this is not a match

So from the point of view of the DNA cubes each three letter codon of DNA matches to its opposite or switched numbers in Nine Star Ki. The Hexagrams only match in two pairs. e.g. 6/9 is with 9/6 this switch applies in all cases. Except the last. So for the direction 4/7 is moving towards the centre where it will meet up with 7/4 are they mirror images of their nine star ki numbers. If I was looking in a mirror and I was 3/6 I would see 6/3. We know that mirror images cancel each other out so although we have all this DNA it will all cancel itself out and we are left with nothing at the centre. Except for 8/8 and 2/2 which belong to a group called alerts because they don't always conform to the usual patterns and once again they are not conforming here.

Map 917 S.E. and N.W. Directions as a Mirror of its DNA and Nine Star Ki

9/1 Hex 63      1/9 Hex 40

8/9         56      9/8         22

7/8         41      8/7         31

6/          43       7/6         10

3/4        42       4/3          32

2/3       16        3/2         24

1/2         7        2/1            8     Pair of Hexagrams

6/6         1        4/4         57     Alert this is not a match

So from the point of view of the DNA cubes each three letter codon of DNA matches to its opposite or switched numbers in Nine Star Ki. The Hexagrams only match in two pairs. e.g. 9/1 is with 1/9 this switch applies in all cases. Except the last. So for the direction 8/9 is moving towards the centre where it will meet up with 9/8, are they mirror images of their nine star ki numbers. If I was looking in a mirror and I was 8/9 I would see 9/8. We know that mirror images cancel each other out so although we have all this DNA it will all cancel itself out and we are left with nothing at the centre. Except for 6/6 and 4/4 which belong to a group called alerts because they don't always conform to the usual patterns and once again they are not conforming here.

Map 916 East and West Directions as a Mirror of its DNA and Nine Star Ki

DNA Sitting in the West facing Centre or East

9/2 Hex 36        2/9 Hex 35      Pair of Hexagrams

8/1         39        1/8           4

7/9         38        9/7         49

6/8         26        8/6         33

4/6         44        6/4           9

2/4         20        4/2          46

1/3         40        3/1            3

7/7         58        3/3           51     Alert this is not a match

So from the point of view of the DNA cubes each three letter codon of DNA matches to its opposite or switched numbers in Nine Star Ki. The Hexagrams only match in two pairs. e.g. 9/2 is with 2/9 this switch applies in all cases. Except the last. So for the direction 8/1 is moving towards the centre where it will meet up with 1/8, are they mirror images of their nine star ki numbers. If I was looking in a mirror and I was 8/1 I would see 1/8. We know that mirror images cancel each other out so although we have all this DNA it will all cancel itself out and we are left with nothing at the centre. Except for 7/7 and 3/3 which belong to a group called alerts because they don't always conform to the usual patterns and once again they are not conforming here.

Map 915 North and South Directions as a mirror of its DNA and Nine Star Ki

4/9 Hex 50        9/4 Hex 37

3/8         27         8/3        62

2/7         45         7/2        19

1/6           6         6/1         60

8/4         53        4/8         18

7/3         54        3/7         17

6/2         11        2/6         12 Pair of Hexagrams

1/1         29        9/9         30 Pair of Hexagrams

So from the point of view of the DNA cubes each three letter codon of DNA matches to its opposite or switched numbers in Nine Star Ki. The Hexagrams only match in two pairs. e.g. 3/8 is with 8/3 this switch applies in all cases. So for the direction 4/9 is moving towards the centre where it will meet up with 9/4, are they mirror images of their nine star ki numbers. If I was looking in a mirror and I was 2/7 I would see 7/2. We know that mirror images cancel each other out so although we have all this DNA it will all cancel itself out and we are left with nothing at the centre.

Map 914 We are all going Somewhere on the Wheel of Life

Imagine yourself on this wheel called Life. I am in the North East or bottom left hand corner second in from the centre. TGC. Always read the DNA as though clockwise. Does this mean I am relatively close to the centre of the wheel and not on a hairy ride on the outer edges. If you want to work out were you are on the wheel refer to Map 215 which converts Nine Star Ki numbers to DNA letters.

Map 913 DNA Codons of Directions as Squares

In the square shapes there are only two angles 90* and 45* and the Pikachu centre is now lost to a Hexagonal shape. The following is a list giving the cube count for each of the elements and each of the directions.

There are 24 squares in each direction and 48 squares of each of the four elements of DNA Fire T Orange, Tree/Air G Yellow, Earth A Green, Water C Blue.

Maximum and Minimum Elements in the Directions

The maximum amount of Fire can be found in the South and also the W and N.W. Now the metal areas are not happy to have fire there according to the rules of Fire destroys or changes Metal, but if an alchemist is at work it may be a different story.

The minimum amounts of fire can be found in the S.W. Which is surprising because isn't the South Fire supposed to support and create Soil energy.

The maximum amount of Air/Tree energy is found in the S.W. And yet Tree/Air energy is controlling Earth perhaps this is why because it is at maximum strength here.

The minimum amount of Tree/Air energy is in the S. W. and N.W. Tree/air supports and creates Fire maybe it is to cover the lack and W. and N.W. Are usually controlling the Tree/air energy perhaps again because it is at maximum strength.

The maximum amount of Earth is found in N. the E. and the S.E. Earth controls the North possibly because it is found in excess here, and E. and S.E. Energies usually control the Earth because they are found in excess here.

The Minimum amount of Tree/Air energy is in the N.E. Which is an Earth area and Tree controls Earth perhaps a little too much here.

The Maximum amount of water is found in the N.E. Which is usually an area that controls water, again because of its excess. This is more likely to create the water falling from the top of a mountain so to excess but so long as it keeps flowing not a problem.

The minimum amount of water can be found in N. and E. and S.E. All areas that benefit from having water.

We can see the South, West and North West have the most fire and the least Tree/Air.

We can see the South West has the maximum amount of Tree/Air energy and the least amount of Water energy. So it is being controlled by Tree/Air so that it cannot overly control Water.

We can see the North, East and South East have the maximum amount of Earth and the minimum amount of Water. It looks like the Earth is controlling the water situation so that the Tree/Air energy cannot control it.

We can see the North East has the maximum amount of Water and the minimum amount of Earth. Water falling between a rock and a hard place here, or creating a lake or river in order to best control the water.

So if you have a new idea and want to get it off the ground, what direction would you take ? A new idea would be associated with Tree/Air energy and I think we can see here that a N.E. S.W. Axis would be a good place to be.

Map 912 The Directions of The Codons of DNA

DNA and their Directions

This is a map of the DNA codons in their sitting positions facing centre or opposite positions. E.g. TGC sits in the North East facing centre or South West. There opposing codon is not the same matching pair as you would find in the map of the 64 Hexagrams of the I Ching were TGC 1/7 matches up with CGA 4/1 in this direction map it's partner is AGC 7/1.

Is it only me that can seee Pikachu at the centre?

Larger version:

 

You may prefer to consider the patterns as squares so here is the South section only in a square pattern to give you the gist of it. 

Map 911 Three of the crystals in Solid lines 6/6 - 1/1 - 8/4

Variation in the patterns of the crystals that is easily visible: 6/6 then 1/1 then 8/4

Map 910 8/4 - 7/3 Crystal Earth, Tree, Metal in Lines

This is the 8/4 - 7/3 Earth, Tree, Metal Crystal as broken lines and again as solid lines.

Broken lines

Solid Lines

Map 909 6/6 - 2/2 Metal and Earth Crystal in lines

This is the 6/6 - 2/2 Metal Earth Crystal as broken lines and again as solid lines.

Broken lines

Always so uniform and simple for the 6/6 Crystal

Map 908 1/1 - 9/9 Fire and Water Crystal as lines

This is the 1/1 - 9/9 Crystal that shows us the lines of the crystal as though they had stretched out, banks of colour showing a clearer view of the formation.

Broken lines image.

Lines completely filling in the blanks. Seek out the patterns within the patterns.

Map 907 DNA and Nine Star Ki thinking about becoming active and manifesting