Map 921 All Six Crystals in The Circle of Life

This is an image of all six crystals made into circles to form the circle of life. All life itself can be made from the patterns in this circle.

The Outer edge is Heavenly crystal 6/6 - 2/2 second one in is the 1/1 - 9/9 crystal. This is followed by the double crystal and then the 8/4 crystal is closest to the centre piece which is made from the smaller crystal of the Diamond which has only four codons.

Life is more simple than we think x

Map 920 Abstract Positives and Negatives in The I Ching Hexagrams

Map of Positive and Negative Hexagrams

The green cube is a negative that is hemmed in by positives and has no way to connect other than to a positive. All others can connect to their own kind. Can we reach from a positive to a negative and get around the whole board. Start at any position and mark off neg and pos as you go the plan is to mark off all 64 codons. Good Luck. 

Well I certainly didn't manage it, will you. Beginning and end marked with a heart. x  

Map 919 World Cup Finals as a String of DNA

World Cup DNA

Lets take the dates of the World Cup Finals, change them into Nine Star Ki Numbers, then change them into DNA letters, just what kind of string of DNA would be produced as a representative of the World Cup Finals and what could we make from them.?

1930 7/3           1966 7/3           2002 7/4

1934 3/1           1970 3/1           2006 3/9

1938 8/7           1974 8/6           2010 8/6

1942 Wartime  1978 4/4           2014 4/3

1946 Wartime  1982 9/9

1950 (2) 5/6     1986 (2) 5/7

1954 1/3           1990 1/3

1958 6/1           1994 6/9

1962 2/7           1998 2/6

Sometimes the Final is played in June and sometimes in July hence the variations on the theme. Number 5 is represented as male, I don't think anyone will quibble with football being more masculine than feminine.

Then we have the two dates in 1942/6 that are missing for wartime, do we leave them out altogether because those games are not a part of the DNA of World Cup Finals. I would say yes. Potentially you could add two STOP markers, or even 1/1 water plus water as the lightest of coverings or even a portal. Last but not least you could put in the DNA markers for 4/4 and 9/9 as they would have been the dates they were played. As this is a map of actual world cup finals for me I would leave them out all together. There are no gaps in DNA, as far as we know. 

So what do we get as a string of DNA to describe the World Cup Finals.

GACATCTTATTTTACAGATACAGATTCGACATCTTGCGGGCGTTCTACGAGTTTAGTGCTTTGTAA

So what could we make from this DNA. Enjoy the world cup wherever you are in the world and know that we are all a part of the whole. X  

Map 918 Another look at the directions of the Crystals Variations

There is no doubt about it the simplest of the crystals is the 6/6 Crystal and then the 1/1 Crystal

6/6 Crystal – Read left to right CCC, CCT, CTT, TTT

Read right to left TTG, TGG, GGG, GGA, GAA

Read left to right AAA, AAC, ACC

1/1 Crystal read from left to right GCG, CGA, GAT, ATA,

read from right to left TAC, ACG, CGC, GCT, CTA,

read left to right TAT, ATG, TGC

8/4 Crystal read from left to right GAC, ACA, CAC, ACT, CTC,

read from right to left TCT, CTG,TGT, GTG, TGA,

read from left to right GAG, AGA

A change of angle for the 8/4 

Small 3 codon Diamond Crystal read left to right CAG, AGT, GTC, TCA

Double Crystal - 24 Codons read left to right TCC, ATC, AAT, CAA, GCA, GGC, read right to left CGG, TCG, TTC, ATT, CAT, CCA, GCC, AGC, 

AAG, TAA, GTA GGT, AGG, TAG, TTA, GTT, CGT, CCG

Its clearly more difficult for the double crystal to change direction because of its size.

Ending on CCG would be ready to start off again reading right to left TCC.

Clearly there may well be more ways to tie them together direction wise but this batch I would say are the best of the bunch. The direction DNA takes has to be a vital part of what it creates. x

Map 917 The Curves of The Crystals Part two 8/4 Crystal, 6/6 Crystal and Diamond

Map 916 36 Triangles of DNA to make a Life

DNA Map of Life

From just 36 triangles all 64 codons of DNA can be read. In this particular combination there are 9 Fire, 9 Earth, 10 Tree/Air and 8 Water. A perfect balance would be 9 of each but nevertheless this map with its excess of Tree/Air would be able to create everything in life. Could it be that we are

all of us born with our own 36 triangles and some have an excess of one or two elements and they tend to bring more of that life experience to the world. For example this could be someone in the media using Tree/Air energy to communicate verbally, a reporter or writer for example. Someone with an excess in water could be more spiritual etc., So maybe those with 9 of each element are the most balanced and harmonious of us. Lack of judgement of others would be required if we could prove we were just being what we have been given as tools x

Map 915 Four cubes to Make The World

                                                   1                   2                   3                   4                                                 

It takes just four cubes to create all 64 Codons or twin Hexagram cubes of DNA.

The Larger cube shows one side of the cube the smaller cubes shows its opposite side.

So to the left we have cube 1 CCC and GGG using this cube alone and using The Ho Tu or The Word Map of The I Ching which is positioned at 28143976 all of the diagonal hexagrams (8) from top left to bottom right of the map are made from this cube.

The cube to the far right AAA and TTT can make all the codons of DNA(8) from the top right to the bottom left of the map. With these two cubes alone we have created an X across the map making 16 codons.

The second cube to the left above shows CAA below and GTT above and from this cube 24 codons 8 in the Fire quadrant, 4 in the Water quadrant, 4 in Tree/Air and 8 in the Earth quadrant. 

The second cube from the right above shows AGG below and TCC above and from this cube 24 codons 4 in the Fire quadrant, 8 in the Water quadrant, 8 in the Tree/air quadrant and 4 in the Earth quadrant.

The mix of the four cubes shows this pattern below. Again they conform to pattern.

We can see cube one creates a diagonal line top left CCC Earth to bottom right GGG Heaven. 

Cube two creates a pattern that is very strong in Fire and Earth.

Cube three creates a pattern that is very strong in Water and Tree/Air.

Cube four creates a diagonal line top right TTT (Earth and Heaven combination) to bottom left AAA (Heaven and Earth combination). 

So all four cubes are about making patterns of Heaven and Earth in varying degrees. 

Excuse the clarity of the colours in the cubes above as they are casting shadows and making the colours look different.  The colours as are stated in the letters. I have added below the colours opened out as I do not know how to type it as a cube with colours.

Anyone for Ludo?

Map 914 S String of God like Dominoes or A String of DNA

Domino another word for God............another way of expressing DNA codons.

AGACACCCCCTTTAAGCCGTTGGG

How many ways to say I love you x

Map 913 The Cube of DNA and its matching Cube

This is a set of all 64 codons in Hexagram order each pair of hexagrams makes a cube GGG can be seen above and its shadow or rear view is three blue sides for CCC all pairs of hexagrams make up a cube but they also have a matching pair which create the other cube by flipping the original over from left to right and then top to bottom. So only 40 codes are required.

List of Codons and their matching partner, some have no match, some have a matching cube, with just one match of four codons to one cube only. 

1/2 GGG – CCC No other

3/4 CAT – ATC - 39/40 CTA – TAC

5/6 AGA – TGT -  No other

7/8 CAC – CTC       “

9/10 AGG – GGT - 43/44 GGA – TGG

11/12 AAA – TTT -  No other

13/14 GTG – GAG -         “

15/16 CCA – TCC -   24/23 ACC – CCT Reverse Hex

17/18 GTC – CAG -   53/4 CTG – GAC

19/20 AAC - CTT  - 46/45 CAA – TTC Reverse Hex

21/22 GCT – ACG  - 56/55 TCG – GCA Reverse Hex

25/26 GTT – AAG  - 33/34 TTG – GAA

27/28 ACT – TGA  - 62/61 TCA – AGT Reverse Hex

29/30 CGC – GCG  - No other

31/32 TTA – TAA -   42/41 ATT – AAT Reverse Hex

35/36 TCT – ACA -   No other

37/38 ATG – GAT -   49/50 GTA – TAG

47/48 TGC – CGA -   59/60 CGT – AGC

51/52 GCC – CCG  -  Matches itself

57/58 CGG – GGC              “

63/64 ATA – TAT  -   No other 

The 20 cubes required to make the above can also be further reduced so that only four cubes are required. Oh what a simple world. x 

Map 912 The Curves of The Crystals of DNA

Our first example is of the 1/1 - 9/9 Crystal.

The 1/1 – 9/9 Crystal cons

ists of GCG, CGA, GAT, ATA, TAC, ACG, CGC, GCT, CTA, TAT, ATG, TGC.

The higher smaller pattern is uniform in its colours. If you filled in the blanks they would just be straight lines of vertical colour.

The lower bigger pattern swops all T's for A's with C & G remaining the same. C & G would be straight lines of vertical colours but T & A swop over just as they do in the making of the twins of Hexagrams. 

This pattern goes from North to South before it turns inwards and changes the direction of reading again.

So in both cases the bottom half is read left to right and the top half is read right to left.

Lets see what happens if we create the double crystal, does C & G change or is it still T & A.

So does the horizontal remain straight and the verticals curve around themselves. I wonder. x