Map 800 DNA Bases and Their colours

Having watched the Royal Institute Christmas Lectures I make the following observations:

Astrology and DNA

I cant help but wonder how the colours of the bases of DNA in science became as follows:

T – Thymine – Yellow – Fire

G – Guanine – Green – Air/Tree

A – Adenine – Blue - Earth

C – Cytosine – Orange Red - Water

I find it hard to believe that the colours above match well with the elements they represent. I know science tries its hardest to stay away from astrology and its elements of Fire, Earth, Air and Water but is this a deliberate distraction.

For me the following fits much better:

T – Thymine – Orange – Fire

G – Guanine – Yellow – Air/Tree

A – Adenine – Green – Earth

C – Cytosine – Blue – Water

 This is an image of the 6/6 Crystal as a wheel or astrology type chart:

It shows how in area one, Earth, some of it is still coming from the past yellow area (air) and some is moving into the future blue area (water). In this particular case the 6/6 crystal is very neat and orderly as one would expect of Heavenly energy but if we look at the next one the 1/1 crystal is now much more dispersed that the 6/6.

 

The 1/1 crystal has now spread itself about more. My own DNA reference TGC can be seen in the 3rd house of communications.
So I think not to connect, Astrology with the I Ching and The I Ching with DNA, and DNA with Nine Star Ki and so on would be a missed opportunity.
In particular in the cases of different base codes which make the same amino acid e.g. CCC and CCT both make Proline.
With more choices CCC can also be described as Proline... Hexagram number 2...Hexagram word Earth...musical tones D# G B... Nine star Ki 2/2... Position centre... Binary 000000... Element Earth/Earth... Planets Saturn/Saturn... Shape Grand Trine in Water... Houses and signs Cancer 4th, Scorpio 8th, Pisces 12th...I Ching Lines Jin, Jin, Jin, Jin, Jin, Jin...belongs to the 6/6 Crystal in the IC bottom peak position...First C Cancer chest...second C Sexual organs...third C feet.
Now the same amino acid must be different in some way and CCT makes Proline...Hex number 23...Hexagram Words Strip Away...musical tones D# G G#...Nine Star Ki 2/8...NE sitting SW facing position...Binary 000001...Element Earth/Earth...Planets Saturn/Saturn... Shape 120* x 30* x 150*... Houses Cancer 4th - Scorpio 8th...Sagittarius 9th...I Ching Lines Jin, Jin, Jin, Jin, Jin, Jang...belongs to the 6/6 crystal in the 5th house position... First C chest...second C Sexual organs... third T Liver.
So they both make Proline but they have differences which could mean they make Proline in a specific area of the body. CCT moving to the Liver whilst CCC heading for the feet. All food for thought and as much thought as we can muster is the best so please don't discount the old ways in favour of the new which in a lot of cases has come via spiritual routes. If looking at The I Ching can produce over 800 blog pages it has to be worth a peek.

If not looking at astrology is something you like to mention then you are no Einstein.  Enjoy your thoughts. x

Map 799 Amino Acids and their communications

Good morning I thought I should communicate with you in a DNA manner and thus have left you the following message.

CACGCCCCCCCTTACTAAAACGAATGGTAGTATGAGGCTAGATGA

If you cannot fathom it try Map 14 for a little help. x

Map 798 36 Triangles of Solo Man's Temple for December, 2013

Solo Man's Temple for December, 2013

I know I said I wouldn't list another 36 Triangles but it is Christmas and I love doing it so much.

This is a game whereby all 64 codons of DNA can be read in the pattern of 36 triangles. Of course there can be more than 36 triangles but I have found the lowest amount of triangles that can contain all 64 codons hidden amongst it to be 36.

Give it a try you will soon be hooked. As you don't have the game you can either make one on your word program from colored triangles or just write down the letters of the colours T for Orange G for Yellow A for Green and C for Water. Or use a felt tip pen to colour in the shapes.

When you think you have included all DNA count up your triangles and then try to reduce them down to 36.  Then check them against the list below as is often the case you may find you have used the same letters twice and will have to amend it.  Good luck and enjoy and Merry Christmas x 

 

CCC CCT CTC CTT TCT TTT

CCA CCG CTA CTG TCA TCG TTA TTG

CAC CAT CGC CGT TAT TGT

 CAA CAG CGA CGG TAA TAG TGA TGG

ACA ACG ATA ATG GCG GTG

AAA AAG AGA AGG GAG GGG

This is the 64 codons reduced taking out any that read the same backwards e.g. CGT is in but TGC is not. 

Of all the thoughts I have had over the years this one is my most perfect. I can pick it up and meditate my way through it anytime the fancy takes me. I hope you enjoy it too. x

Map 797 The Laws of Attraction

Life and its Opposites

The very act of observation creates a bridge or a relationship between the observer and the observed. It is called spooky action from a distance. How very scientific ! Try to imagine something that is strong in your hearts desire and bridge that gap.

The image of the bridge above looks remarkably like the symbol for Libra which is all about relationships. Once you start to think about your hearts desire a connection forms and the more you think about it the stronger that connection becomes. One particle has become connected to another particle. I also believe that in some cases our DNA is encoded to want to attract certain things into our lives. These particles are encoded to react together even when separated and in ways hidden from us. So perhaps out desires are born with us, not in all cases, e.g. a cream cake, but in major ways certainly. We are also capable of attracting anything and everything in our direction but perhaps its easier to attract those things that are encoded in us from birth.

So we have the bar of attraction or the bridge between them and particle A is turning clockwise and particle B is turning anticlockwise. Having said that if I am standing in position A looking towards B that's true but if I am standing in position B and looking towards A then I realise that B is now clockwise and A anticlockwise. So although they appear to being moving in opposite directions are they in fact doing exactly the same rather than the opposite.

If you consider the bridge to be like a piece of studding. A threaded metal bar we can see from the item above they are in balanced and harmonious positions to each other on the bar. In the studding image below we can see that both hexagonal nuts have moved to one end of the bar and that does not bode well for balance and harmony. Interesting that a nut is hexagonal, it doesn't need to be.

The higher the vibrational connection you have to your hearts desire the better your chances are of succeeding in attracting this into your life. The strength of the vibrational essence of your desire opens up pathways and if you take the path of least resistance your journey will be made easier. If your journey is from A to B then it could be unbalanced and less harmonious even if you get results but if A moves towards B with the same strength as B moves towards A then they meet in the middle and this is a more balanced and centred meeting point.The half way house.

Remember if your not feeling it, its not going to happen. The stronger your feelings the more likely you are to attract into your life all that you desire. Desire follows will, as Deepak Chopra says, “it has no choice”. Feel it, get that sense of anticipation you get when something new is about to happen. Your vibration is poetry in motion, with the right strength your new vibrations are matching up to their opposite particle and in every moment your desires can come alive. Desires are in constant search for a heart that is willing to yearn for them. “It” is already out there you just need to find the light and see it.

Passion finds desire and together they are manifest. The way you see your life is the way it will turn out. So don't start complaining when things aren't what you would like them to be.  Do something about it and change your world for the better. Merry Christmas. x

Map 796 The I Ching Chess Set

Just a few examples of 1/7 ..... 7/9 ..... 7/2 ..... 2/2 .....

What shape do you make how much of the board do you cover.

I wonder what to make of the King 2/3 and 6/4 and the Queen 2/4 and 6/3?

Myself I am in the open board position.

Map 795 Blanket by Suzanne Sharp at The Rug Company

This is the sort of design you can do when you change thinking into art work. This beautiful rug is DNA all over, The Hexagrams all over, Nine Star Ki and so on. Simply lovely and useful unlike some of my random thoughts.

Map 794 The First 24 Hexagrams and their Elements

This is the first batch of 8 hexagrams. The hexagrams are made up from and 8 x 8 grid which creates 64 different codons so I think examining them in groups of 8 is a good idea.

We can see that the most common element comes from the letter C Water with 5 upward pointing triangles and 4 downward pointing triangles. Fire has 4 up and 1 down with earth being the opposite with 1 up and 4 down. G has 2 up and 3 down just 5 tree/air element triangles which is puzzling since this is the starting point of the hexagrams and GGG is all tree/air. So this count shows us Water dominates in the first 8 hexagrams and all other elements are equal.

Now for the second batch of 8:

This is the second batch of 8 hexagrams. The hexagrams are made up from and 8 x 8 grid which creates 64 different codons so I think examining them in groups of 8 is a good idea.

We can see that the most common element comes from the letter G Tree/Air with 4 upward pointing triangles and 4 downward pointing triangles. Fire/T has 5 up and 1 down with earth being the opposite with 1 up and 5 down, C/Water has 2 up and 2 down and is the smallest element here.

So Tree/Air/T dominates and Water/C is the weakest.

Batch 3:

This is the third batch of 8 hexagrams. The hexagrams are made up from and 8 x 8 grid which creates 64 different codons so I think examining them in groups of 8 is a good idea.

We can see that the most common element comes from the letter C Water with 5 upward pointing triangles and 5 downward pointing triangles. Fire/T has 2 up and 3 down with earth being the opposite with 3 up and 2 down, G Tree/Air has 2 up and 2 down and is the smallest element here.

So Water C dominates and G Tree/Air is the weakest.

 

Map 793 The Pyramids as DNA Hexagrams

Similarities?

Or just the same message?

Whatever floats your boat.

I guess this boat could be called Unity the Heavenly energy of GGG before it decides to create Earth.

Map 792 The Movement of DNA

This is the 1/1 crystal with its Nine Star Ki positions and their sitting and facing directions. The lines start at the bottom of the crystal 9/9 and move upwards through the right hand side of the crystal until finally ending at 1/7 before 9/9 repeats itself again. It looks a bit like the underground, aka The Knowledge.

How energies move must play an important role in the movement of DNA.

Every amino acid in our body has a physical electromagnetic compliment to something in our environment. Or for every proton there is a matching partner which seeks us out. So long as the environment wants what we have to give we will be fine otherwise we become extinct. Clearly the Dinosaurs ceased to have what the environment around them wanted.

If we call this attraction desire and understand that it seeks out what we have only if it want's it that's the power of attraction, that desire is the field of all possibility. In the Celestine Prophecy James Redfield talks of the jew's belief in an arrow of time that proves the world has purpose and direction. Could it that our DNA is very much about arrows and their directions. Leibniz talks of the art of combinations and the unstable position of an arrow when it is in flight until it moves forward to its destination. We can also call on Schrödinger’s cat here until the arrow arrives at its destination it can be diverted elsewhere so it is literally up in the air until it finds its electromagnetic compliment and could be anything.

It could also be that we are born with our DNA and its potential actions but we also have RNA which can change things as we go through life and are changed ourselves. We cannot attract our complimentary opposite until we are in a position to do so. Our message that we bring to the Earth could be locked inside us forever if we don't get into a position to receive the energies required to ground them.

6/6 Crystal and its movements...

Not quite the underground. 1/1 is more spread out like a train track, 6/6 is more enclosed and together.

Interesting prospects for the movement of DNA. 1/1 crystal more inclined to seek out freedom and spread out but 6/6 is more contained and happy to stay closer together.

Map 791 The Twisting and Turning of DNA in the 1/1 - 9/9 Crystal

Map 790 The DNA Christmas Tree of Life

This is the DNA Christmas Tree. As you can see the left hand side is the orange T and Green A with the Star of David on top. The right hand side is the Blue C and Yellow G again with a Star of David on top. Each triangle or section of the tree has three colours to it and these make up all 64 codons of DNA. They also have hexagram numbers which have been added and you can see how the hexagrams connect to each other as they do in the crystals. You could make a very pretty tree with tinsel connecting the hexagrams the top and bottoms connecting across horizontally and the centre triangles or branches on the left are diagonally connected and on the right vertically connected. Only four cubes or gifts are required to make all 64 codons of DNA.  It certainly is The Tree of life.

My own Hexagram 47 hangs from the Blue/Yellow tree at the base and swings in a horizontal manner. Perhaps the feeling, sensitive type. 

The gifts or cubes can be turned to show three sides and all 64 codons can be made from these four cubes alone. 

Merry Christmas to you all x

Map 789 The Twisting and Turning of the DNA Crystals 6/6 - 2/2 Nine Star Ki

This is the image of the 6/6 crystal above and the way it would look as a strand of DNA showing us how the right hand side is flipped over to fit the DNA shown on the left hand side.

This strand shows how T and A are partners and G and C are partner. Even when we look to the alerts in the Hexagrams and Crystals we find they still match up T to A and C to G.  This is a slight curve but I guess they can dance about into varying different shapes if they so choose.

When they twist and turn and one of the letters is covered at centre we still know what it is going to be because T and A match and C and G match up.

All crystals behave in this same manner.

Map 788 Nine Star Ki Quilt for 1/7/8

Map 787 A Crazy Colourful World

Can you imagine yourself surrounded by four different colours, green, yellow, blue, orange or CTGA. Dna potential just waiting to attract to your desires. As each triangle pushes its way towards you it pushes another out of the way and makes them move in another direction. One Orange triangle could potentially be taking 8 different directions. So be sure you want what you are getting out of life because you give up something else in order to achieve it.

So when a Mother says "I gave up my career for you", she should say, "I gave up something I loved for you because I loved you more".  Same story different feelings and different energies attracted or taken away by the strength of those feelings. So if you use words choose them wisely.

Imagine everything your heart desires, don't force it adding tons of material items but by all means choose as many material items as your heart truly desires. If the feeling is not strong it wont attract so better to achieve the important goals than to weaken your strength of desire by a list that is too long to remember let alone feel in the heart.

If your not feeling it, it wont attract. Words can attract but feelings much more so. When you look at the house of your dreams and your heart sings that is most attractive to the Universe. If you think well I might go for a more expensive or luxurious one then if this Universe thing works but it doesn't truly create those feelings in you it simply wont come about. Feeling your hearts desire in the heart works best for the Universe.

Move some triangles today x

Map 786 Port Sunlight House Design

The beautiful housing estate of Port Sunlight built by Lord Leverhulme has so many original and different designs but this one took my eye. The first image is of six parts of a pattern on the front of a house. What do you see.

My husband could see the X Factor firstly which I could see also once it was pointed out to me.

Then I saw the four which were also 16 connected by a diagonal cross to each of the four smaller squares and by a vertical/horizontal cross connection to the four larger squares. Of course 4 x 4 x 4 gives us the 64 hexagrams of the I Ching.

But for me on seeing this pattern I saw a black square outer with a white square to the inner with four black crystal like shapes protruding into the white centre. Or for the more sporty a couple of weights.

Of course now I am looking more closely the four squares connected by an X is most prominent but its very likely the way ones mind works that we see what we think most about and as you know for me the crystal shape is so important.

We see this pattern in The I Ching and Dna too.

Enjoy your day x

Map 785 The I Ching Hexagrams in Pairs

 

This is the 64 Hexagrams of The I Ching and of Dna in pairs 

of numberical connection. Note that they match up diagonally

T becomes A and C and G  remain unchanged

If the hexagrams contain only C & G then they swop over

The exceptions are the alerts.

Map 784 The Alerts in The Hexagrams of The I Ching

8/3 and 3/8 both work on the North South axis.

4/7 and 7/4 both work on the South West North East axis.

8/8, 3/3, 4/4, 7/7 all work from the centre point.

If we know that the behaviour of one particle or Hexagram is connected to a partner and they move in similar but opposite ways even when working from a distance and we know that each of the hexagrams has a pull on the other then I feel sure they must be working on the same axis. In the case of centres they must work in an above and below manner but for ACT 3/8 which is in the South facing North it must work best with TCA 8/3 which is in the North Facing South and they could then be on the same axis and facing each other in a push and pull manner. 

Both operate in the same manner but if the centre is like a mirror 3/8 looking in a mirror would read 8/3. Jupiter is about expansion and Saturn is about restriction again opposite concepts. 4/7 and 7/4 would be working the same way on the SW/NE axis perhaps they have swopped hats so they don't mirror each other. They have a Jupiter expansion with Venus hence their potential to experience growth in wealth and prosperity or your appreciation of beautiful things.

Hex 62 TCA 8/3 is associated with Aries 1^st House – Scorpio 8^th house – Capricorn 10^th house

producing an Aries to Scorpio quincunx – a Scorpio to Capricorn sextile – a Capricorn to Aries square. Feeling, thinking and doing energies.

Hex 61 AGT 7/4 is associated with Taurus 2^nd house – Libra 7^th house – Sagittarius 9^th house producing a Taurus to Libra Quincunx – a Libra to Sagittarius Sextile – a Sagittarius to Taurus quincunx. Forming a Yod or finger of God aspect. Projection of ideas can manifest.

Hex 28 TGA 4/7 is associated with Aries 1^st house – Libra 7^th House – Capricorn 10^th house producing an Aries to Libra opposition – a Libra to Capricorn square – a Capricorn to Aries square. Three red doing energies very active indeed could act before you think.

Hex 27 ACT 3/8 is associated with Taurus 2^nd House – Scorpio 8^th house – Sagittarius 9^th house producing a Taurus to Scorpio opposition – a Scorpio to Sagittarius semi-sextile – a Sagittarius to Taurus quincunx. Thinking and active energy can cause stress and anxiety without much relaxation.

ACT 2^nd - 8^th - 9^th houses ….. 1^st Quadrant and 3^rd quadrant.

TGA 1^st - 7^th - 10^th houses ….. 1^st quadrant, 3^rd quadrant and 4^th quadrant.

TCA 1^st - 8^th - 10^th houses ….. 1^st Quadrant, 3^rd quadrant and 4^th quadrant.

AGT 2^nd - 7^th - 9^th houses ….. 1^st Quadrant and 3^rd quadrant.

1	2	3	4	The	6	7	8	9
				5
9	6	8	7	Equaliser	2	4	3	1

So when we match up centre numbers and Hexagrams 1/1 can become 9/9, 2/2 can become 6/6, 3/3 does become 8/8, 4/4 does become 7/7. From this we see 1/9 can become 9/1, 2/6 can become 6/2, 3/8 should become 8/3 (but is matched with 4/7), 4/7 should become 7/4 (but is matched with 8/3).

Could it be that in centre numbers there is no opposite because it is already at the centre balanced and harmonious. So 3/3 can become 8/8 and 4/4 can become 7/7. When it comes to those on an axis they are not balanced and harmonious but trying to find balance. So they have to pass through an equaliser which changes them. So when ACT 3/8 is on an axis with TGA 4/7 it is a problem because change cannot occur. Perhaps this is when TGA 4/7 shouts STOP.

My apologies for rambling on about ALERTS but that is the purpose of thinking. Observing and wondering why. More work needs to be done here because I still cannot see good reason for the sharing of hats in this particular set of Hexagrams. If you think of anything do let me know. There is probably a perfectly simple scientific reason that I am unaware of because my inroad is through The I Ching.

Keep thinking x

Map 783 The Tree Spirit Inspired by Jane Roberts Living in Two Worlds

One day Thomas decided to have a picnic on the banks of the river that ran

through the nearby wood.

“Mum, can I have a packed lunch today? I'm going into the woods to do some

sketching.” 

 “You and your drawings,” said Mum. “Okay give me a few minutes.”

Thomas used this time to throw a few things into his backpack and then he was off. It was a glorious day, the Sun bursting with light casting pretty shadows across the wood. As a budding artist Thomas could see the beauty of nature and this was perfect for sketching.  He found himself a seat on the trunk of a tree and started to draw a picture of the tree on the opposite side of the bank. It had been cut down recently and had fallen across the river at an angle. A once magnificent tree covered in pretty blossom.

Thomas stopped to take a break for lunch and lay back on the bank listening

to the birds busy about their work.  He tried to imagine a life without the sound

of birds, it was unthinkable. What a sad world it would be, without the animals of the wood; foxes, squirrels, badgers, hedgehogs...

“Psst.” Thomas looked around but saw nothing. He continued with his list;

birds, insects, frogs, herons, fish...

“Psst.” Thomas jumped up and looked around but saw nothing out of the

ordinary. He decided to carry on with his sketch and that's when he noticed part

of the tree in his drawing was missing.  Puzzled he decided to investigate.  Climbing onto the trunk of the tree he scrambled over to the other side of the

bank.  As he jumped down from the tree he heard the now familiar sound,

“Psst.” He swung round quickly and was shocked to see a little man in

front of him.

“Oh a gnome,” said Thomas in shock. The little man was floating about 10cms

off the ground and was about 20cms in height. He wore three quarter length trousers and a hat with three triangles in orange, yellow and blue. His face was a brownish grey colour and he had a long curved, smiling mouth, with small eyes and a flat nose.  He appeared to be floating with a backward motion, and had a very proud look on his face.  He was standing beside the tree that Thomas had been sketching.  He didn't speak, but somehow Thomas sensed that he wanted him to know that this was his home.  He wanted him to feel the love for the tree that he also felt.

Thomas asked, “Are you a gnome?” The gnome didn't reply but sensed to

Thomas, “No I'm a Tree Spirit.”

“Is this your tree?” he asked, and the Tree Spirit sensed back that indeed it was his tree and had been his home until it had been cut down, now he was homeless.

Just at that moment a beautiful orange butterfly flew past and the Tree Spirit turned and waved a friendly farewell to her.

“Do you know that butterfly?” asked Thomas.

“Yes,” sensed the Tree Spirit, “she was one of my pets but as I no longer have

my own home she must move on and try to find a new home for herself.”

Thomas sat down on the tree and traced his hands across the flowers so prettily draped on the dying trunk.

“Did you grow these flowers?” he asked.

“Yes I'm very house proud,” sensed the spirit.

“Why did you speak to me?”

“I'm desperate, oh, no offence. Its not usual for Spirits to talk to humans but I have seen you here many times and I know that you have special feelings for the wood and the trees. Not to mention the wildlife,” sensed the spirit.  “My butterfly has lost her home. I have lost the eggs from the nests I had in my branches and I must find a new home for my pet mouse, squirrel and snail before the winter comes.”

“Well what's your problem?  Just put them in another tree,” said Thomas.

“All the trees in the wood have their own spirits and pets, there is no room for

the spirits left homeless when trees are knocked down and not replaced,” sensed the spirit sadly. “The only thing that can save me is if I can find a newly planted tree which doesn’t yet have its own spirit.”

“Hmm,” said Thomas. “I really don't know how I can help. It's not that I don't

want to help you, it's just, well I'm only a boy, what can I do?”

“You could persuade your Mum to plant a tree in the woods, then I would have

a new home instantly,” sensed the spirit grinning, suddenly looking much

happier.

“Mum always said she meant to plant a tree when I was born, I don't think she ever got round to it. I could try to persuade her to do it now,” said Thomas.

Thomas started to think of how he could get his Mum to plant a tree in the  wood. In his garden perhaps but in the wood, now that would take some

explaining.

“I realise that,” sensed the spirit.

“You realise what?” said Thomas.

“That your Mum would think it odd that you wanted to plant a tree in the wood

rather than in your own garden.”

“How did you know what I was thinking?” asked Thomas.

“Oh, did I not mention, I can read minds.  That's how I knew I would be safe talking to you,” he sensed back.

“Oh, how very clever of you,” said Thomas chuckling to himself.

“Do you think you will be able to persuade your Mum to plant a tree before the

winter comes,” he sensed.

“Well I will have a jolly good try,” said Thomas. “What will you do in the

meantime and what will happen to your pets?”

“Do you think it might be possible for me to come home with you tonight?  My

neighbours will give my pets shelter until I return and I would love to see where you live,”  he sensed. “At least I'll know whether or not I can keep them when I get back.”

“Home with me, whatever will Mum say,” thought Thomas.

The spirit jumped onto Thomas's right shoe and hugging his leg sensed “easy

don't tell her.”

“I really couldn't do that, I always tell Mum the truth and I never keep secrets

from her,” said Thomas.

“How odd you are Thomas, but somehow I sense that you're right. Maybe we

could just tell your Mum, do you think she will give me away?” sensed the

spirit.

“No, not at all. In fact I think she'll be tickled pink with you,” said Thomas

laughing. “Well come on then gnome, lets go and find Mum before we lose our

nerve.”

“Gosh what's Mum going to say?” thought Thomas.

“Don't worry,” sensed the gnome, “I'm sure everything will be fine.”

“Oh, I must watch what I think,” thought Thomas and then laughed when he

realised the gnome would have sensed that too.

When he looked around the gnome was grinning. Thomas lifted him up

carefully and rested him on his arm. “Are you comfortable?” asked Thomas.

“Well, yes I am, but I think I should hide in your backpack or you will have some odd questions to answer before we get home.”

Thomas tied his bag onto his back and kneeled down so that the spirit could

climb inside.

“Pull that tie on the top and nobody will see you,” said Thomas.

“Well maybe not me but certainly my hat,” sensed the spirit.

“Take your hat off and put it in the bag then,” replied Thomas.

“My head will stick out then,” he sensed.

Thomas roared with laughter. “I'm sorry, I didn't realised you had a pointed

head as well.”

“You live and learn,” chuckled the spirit.

“Are you getting smaller?” asked Thomas.

“Yes, unfortunately I will continue to get smaller the longer I am away from my

tree.  If I don't find a new home soon I will shrink to nothing and vanish. I am

about 10cms smaller than usual because I have been away from my home for

so long,” sensed the gnome.

“Well let's not waste another moment,” said Thomas.

“No let's not, gee up horsy,” sensed the spirit banging Thomas on the side

of his backpack to get him moving.

“I'm home Mum,” shouted Thomas. 

“Great, leave your shoes at the back door and wash your hands for tea. Did

you did you manage to produce any good sketches?” enquired Mum.

“Yes I've got one I'm pleased with,” said Thomas.

The Tree Spirit chose now to pop his head out of the bag to catch a glimpse

of Thomas's Mum.

Well she looks kind he thought, I just hope she isn't the type that runs screaming just because she's seen a mouse, you'd be surprised how many women are like that.

“Muuum,” drawled Thomas.

“Oh yes and what have you been up to?” asked Mum.

Gosh she can sense things too thought the spirit.

Thomas started to tell his Mum the story of his day, just as it happened.

When he got to the bit about meeting the spirit she said, “Oh what a wonderful story, you must write this down.”

“Mum don't interrupt me until I'm finished,” said Thomas.

Thomas continued his story where he left off, when he finished his Mum said, “How marvellous.” That was a really lovely story, I did enjoy it. Did

you know that when I was a little girl I used to feel sure that one day I would

meet a Leprechaun at the bottom of my garden? I used to spend hours outside

just waiting for him to appear and speak to me. Of course, he never did.”

“Mum I'm not telling you a story I am telling you the truth. This is true and I

can prove it if you promise to keep it a secret. Let me introduce you to a friend

of mine,” said Thomas.

Thomas opened the backpack and asked the spirit to come out. He didn't. He was terrified of grown up's. Thomas realised his fear and gently lifted him out of the bag and placed him on the kitchen table, you should have seen the look on Mum's face, she nearly fainted. She started to sway with shock so Thomas sat her down and slowly told her the story again. This time the spirit was chipping in with his part of the story and by the time they had finished Thomas's Mum cried, “You poor little man, of course we must help you.”

“Gosh so many trees have been cut down in the wood lately you must have lots

of friends who are homeless too.”

“Yes, sadly two of my best friends are homeless,” he sensed.

“What can we do to help him Mum?” asked Thomas.

“What can we do to help him?” echoed Mum, “Lots. First of all you can both

wash your hands and have something to eat, then we will work out our plan of

action. You never get anywhere without a plan. What do you eat little man?” asked Mum.

“I love tomatoes,” sensed the spirit.

“Right, you can have a salad too Thomas, maybe your new friend can influence

you to eat properly. Thomas, get the little chair I keep for my doll.  It's in the attic, little man can use that so he can reach the table and eat with us,” said Mum.

“Okay, come on little man lets go and look for it while Mum makes the tea.”

The Tree Spirit sensed to Thomas, “Why does your Mum keep calling me little

man?”

“Oh that's because she likes you and thinks you're cute,” replied Thomas.

“Oh good, I like her too,” sensed the gnome, blushing.

They found the chair, brought it down to the kitchen and placed it on a chair at the table; now little man could join them.

“You have a lovely home Mrs Mum,” sensed the tree spirit to Thomas's Mum.

“Thank you,” she replied, “and you will soon. Now its time for our plan of action,” said Mum. “When we finish eating I want little man to hide in your

backpack again and we will take ourselves off to the garden centre and see what they have on offer. Dad is away tonight but when he gets back in the morning I shall ask him to plant the tree in the woods. We may need to tell Dad the truth because without his help we couldn't possibly dig a hole big enough to take the roots of the trees, so they can spread and grow into a beautiful home for little man.”

“Okay Mum, but remember it must be a secret for our family alone.”

After tea they set off for the garden centre, the spirit peeking out of the top of

Thomas's backpack. As they drove past the wood the spirit was thinking

“Don't worry wood I will soon return.”

“Don't worry little man,” said Mum, “you will soon be back in your wood,

happier than ever.”

“Yikes I will have to be careful what I think,” sensed the spirit chuckling.

When they got to the garden centre they were surprised to find how many

different varieties of tree they had for sale.

“This one's pretty,” said Mum.

“Yes it is, sensed the spirit,  “but the best tree would be an Oak I could live happily ever after in that.”

“You're right,” said Mum. “We have an Oak in our garden that's 400 years old, now that would be a long time.”

The spirit was that excited he jumped clean out of the backpack and landed

at Thomas's feet grinning from ear to ear. He jumped onto Thomas's foot and

hugged his leg.

“I have a tree house in my Oak tree,” said Thomas.

“My Oak tree is my house,” sensed the spirit. “So now we are like brothers.”

“Well you always wanted a baby brother Thomas, now it looks as though you

have one,” said Mum laughing.

“Three Oak trees please,” said Mum to the cashier.

“Three,” said Thomas.

“Three,” sensed the spirit.

“Yes, its just how I'm feeling today. I'm so excited to help that I feel as though I'd like to plant an entire wood,” said Mum happily.

They took the trees home and left them in the garden in preparation for Thomas's Dad planting them into the wood.

Thomas's Dad, hmm, thought Mum, I wonder what he will make of all this?

“Well boys its time for bed. It would be rather nice if you could spend the night

here little man and go home with the trees in the morning. That is unless someone is expecting you back in the wood tonight?”

“Well actually, no,” sensed the spirit blushing, “I did tell the other spirits

not to expect me till morning.”

“No problem then,” said Mum, “By the way did you know that you look just

like an apple when you blush?”

This made the little Tree Spirit blush even more.

“Can we sleep in the tree house tonight Mum?” asked Thomas.

“That's a great idea, I'll make up a tuck box for you in case you get hungry

during the night. Don't hesitate to shout me if you get frightened Thomas.” 

“He won't get frightened with me,” sensed the spirit.

“Thomas sometimes finds it difficult to sleep because he hears so many noises

at night which usually stop him from sleeping.”

“Well Mrs Mum,” sensed the spirit, “I will explain all the noises of the night

and he will never be scared again.”

Thomas and the Tree Spirit could hardly contain themselves they were so

excited. They collected some blankets from the linen cupboard, picked up

the tuck box and of course Thomas took his watercolour crayons with him.

He was determined by morning he would have a picture of his new friend that

he could keep forever. It would be his most treasured possession. Little man explained the noises of the night to Thomas. He told him how the hooting owls were preparing themselves for the winter, many of the local birds having already started to fly off to warmer climates.

“The autumn is a very busy time for gardens and woods. This is the time

that little people, as you call them, make themselves very busy preparing for

winter. Now is the best time to plant trees. Which is why, having seen you in the wood many times before, I waited until now to approach you. The wood is

alive with Tree Spirits, gnomes, fairies and elves, all busy using their power to create a beautiful world.”

Do you remember the time when you were sledging and you went so fast you ended up in the stream in Totom's Wood?” asked Little Man.

“Yes, I do, did I see you that night, I saw something up on the hill but couldn't make out what it was?” asked Thomas.

“Me and a few friends, we came from under cover because we thought you may have hurt yourself but you just laughed, brushed off the snow and tried again,” said Little Man chuckling.

“Gosh I remember thinking that looks like a little man from here and it turns out I was right. I do wish we could have been friends since then,” said Thomas laughing.

“You will always be our friend Thomas, from this day forward. Well it must be time for us to get some sleep. Sleep well and promise you will never again be afraid of the noises of the night.”

“I promise,” said Thomas sleepily.

They tucked themselves up into their sleeping bags and were fast asleep within

minutes. Well it had been a busy and most unusual day.

Thomas woke first to the sounds of the birds busy about their work. He looked

down at the little man beside him and couldn't help wishing the Tree Spirit

could stay with him forever. He would have to be brave today because he knew

little man was smaller than ever and the chances are he would leave today and

he would not see his 'baby brother' again. He took out his sketch pad and drew

a picture of the little man cosily tucked up inside his sleeping bag. He would

certainly miss this little man.  The Tree Spirit yawned, stretched and shook

himself awake.

“Heavens, it's not at all like me to be up after the birds. That's what comes of

not having my own tree to look after,” sensed the spirit.

“Come on, breakfast time, I'm starving,” shouted Thomas. They ran into the

kitchen full speed ahead.

“Goodness me you two are lively this morning, sit down I'll have everything ready in a tic,” said Mum.

The boys ate heartily in preparation for all the hard work they had ahead of

them.

“Well boys it's time to go down to the wood. I think it would be best for the

time being if little man stayed in your backpack, just until your Dad has planted

the trees,” said Mum.

“But why?” asked Thomas. “I thought you were going to explain everything to

Dad.”

“I was, but well, it's not easy explaining something like fairies and gnomes to

someone like Dad. I'm sure he would think I’d gone potty.”

“Perhaps your right,” chuckled Thomas.

So for the final time the Tree Spirit slipped himself into Thomas's backpack but

not before taking one last look around the garden and speaking to the fairies, gnomes and leprechauns that lived there.

“Look after this beautiful garden for Mrs Mum. She works very hard and it gives her great pleasure. Goodbye, it has been nice to meet you,” sensed the

spirit.

They set off for the wood in Mum's sports car so they could remove the roof and the trees could stick out of the top. They looked an odd bunch, even without a gnome in the back.

After much work on Dad's part the three trees were planted on the bank of the

river.  Not too far apart, so that little man's friends where nearby and not too close that they might obstruct each other in a couple of hundred years time.

“Thanks Dad,” said Thomas hugging his father.

“My pleasure son, I'm just glad to see you taking an interest in your

environment. In fact I’m very proud of you,” said Dad. “The little people

of today are the adults of tomorrow and if they were all like you Mother Earth would have nothing to fear. Anyway, I hope you don't mind I have to leave; I'm due back in the office. See you both tonight.”

Mum and Thomas waved him off, the spirit also waved but from inside the

safety of his backpack.

“Gosh for a moment there I thought he knew all about me when he said the

little people,” sensed the spirit.

“So did I, I jumped out of my skin until I realised he meant children,” said

Thomas laughing.

Thomas's Mum was watching her son and the gnome running and laughing

together. She felt a pang as she realised just how sad it would be when the time

to say goodbye finally arrived.  I hope Thomas will be able to understand why Little Man has to go back to his own world, she thought to herself.

“Lunch is ready,” she shouted.

They came and sat beside her on the picnic rug and ate everything in sight.  Such was their appetite after a night in the fresh air.

“Right boys, its time to tidy up. I want to plant some bulbs around your tree

little man and when they come up every year it will be a reminder to you of the day we spent together,” said Mum trying to sound cheerful.

They managed to finish all the work just as it was getting dark.

“It really is time we were going Thomas,” said Mum.

“I know,” he replied.

Thomas's Mum pulled Little Man towards her and hugged him.

“We have to go now little man,” she said. “I want you to know that it's been

an enormous pleasure to have met you. Most of all though, I want to thank you

for making my childhood dreams come true. I always knew that one day I would meet a little man like you. I hope you will accept this parcel of little

gifts,” she said.

“Oh yes, thank you,” sensed the spirit. “Can I open it now?”

“Yes please do,” said Mum.

Thomas and his Mum sat down on the bank to watch his little face crinkle in

delight as he opened his gifts.  First, a new hat she had knitted for him herself complete with three triangles, then a pin cushion for him to sit on in his new home and finally a tiny gold chain with a heart on it.

“This is especially for you, because you will always be in my heart,” she said.

The Tree Spirit hugged her and sensed, “Thanks Mrs Mum.”

Mum said, “If you ever need us again you know where to find us, just come up to Little House anytime and good luck to you and your friends in your new homes. Goodbye little man.”

Mum kissed him on the top of his head, then turned and walked to the top of the

bank leaving Thomas to say his goodbyes.

Little Man turned to Thomas and hugged his leg, “I'd like to give you a gift as

well,” said Thomas. “It's something from my precious box at home, a pretty

stone I found when I was on holiday in Jamaica. It would make a lovely door

stop for you.  Also a tiny picture I have drawn for your living room.”

“Thank you, they will always be precious to me. I'd like to give you a brooch in the colours of your energy, I didn't think you'd want a hat like mine,” sensed the Tree Spirit chuckling.

“I hope you will keep it always to remember me as I will your gifts.  Remember Mother Earth is very proud of you,” he sensed.

Thomas said his goodbyes and walking to the top of the bank he wiped a tear

from his eye before turning to wave once more. Sadly the Tree Spirit was

nowhere to be seen.

“BE HAPPY,” shouted Thomas. “I WILL,” sensed the Tree Spirit.

Totom's wood was planted at the Millenium 2000 in appreciated of all Tree Spirits everywhere. 

This book was inspired after reading Living in Two Worlds by Jane Roberts where she talks about trees having spirits which at that time I had not heard of but could completely relate to through my love of trees.  I hope you enjoy it and can see that some normal things can come out of intense thinking. Thank You. x