The Double Numbers in Nine Star Ki and their Inward Energy

 I decided to draw up a small 81 part map of Nine Star Ki in a one year with 1/7 at the centre.

The double hearts 1 blue and 7 red show the positions of the 1/7 Nine Star Ki in this pattern. The Gold dot shows the position of the nine star ki 1/1.  As we can see from the image below 1/7 TGC is based at centre and then the other positions follow from that. 1/7 is a nine star ki that is classed as sitting in the North East facing South West. This means that it is facing the 1/1 position in the S.W. When we expand on the pattern the only time the 1/1 is surrounded on all sides is when it is sitting in the centre of the S.W. Position. 

In this position all the surrounding energies are aimed at the 1/1 in the centre of this section. It must be something like a plug hole and all the energy is turning inwards. There are 9 positions for the 1/1 but only one of them sitting in the centre creates this inward energy. The other 1/1’s have only 1, 2 or 3 lines turned inward on them rather than all 8. 

With 1/7 at centre and its sitting position in the North East we see that it forms a large X and two other lines east/west and north/south and then it moves onto the south west position of the plug hole 1/1. So most connected to North East, Centre and South West. 

These rules would apply to any of the nine star ki numbers when the double number is in the centre of a section. No centre no plug hole. 

This is a year 1 so 1 is the first number in every box or year number followed by the rest of the numbers in the month position. So every scenario contains the number 1…………if you start with a 2 year then the same rules apply but every box contains 2 and so on. 

Number 1 year partners with the 9 year so if we use Mar/Dec we work out that its partner is 9/8 ACG and that being the case it would sit in the North West facing South East and the 9/9 plug hole would appear in the South East corner. 

Enjoy your thinking and if you know what the plug hole effect is all about let me know. X 

The Well Being associated with the Double Number in Nine Star Ki

 Observations on the double numbers in a 1 year…….the same rules seem to apply in different positions for all numbers 1 to 9…..

Feb     Mar April     May June    July Aug     Sept Oct

Nov     Dec Jan Months of the year positions…

—————————————————————————-

1-8     1-7 1-6     1-5 1-4     1-3 1-2     1-1 1-9

—————————————————————————-

Position direction wise of each of the nine star ki…

NW     C         SE        E         SW     N         S      NE W

—————————————————————————

Position of the 1/1 double number in each month…this position is our sheng chi or best direction to face …so in my case as a 1/7 sitting at the centre facing S.W. Is my best direction and this is also the position of the 1/1. 

E     SW N     S         NE     W         NW     C         SE

—————————————————————————-

Position of the number five…Seems to be in the usual

position of the month number eg 1-6 has 5 in 6 position

NE     W         NW     C         SE     E         SW     N         S

—————————————————————————

Easy energy Trine (1) - changing energy Quincunx (2) - Same energy conjunct……..(3)

2     3         1     1         3     1         2     3         2

Making 4 of each as Feb, Mar, April count twice. 

—————————————————————————

So we can see here with my chart that 1/7 is at the centre then it counts down through the year…..

1/1 in March/Dec sits in the south west position which is also my Sheng Shi or best facing direction. The Number 5 is in the west which is the usual position of my month number 7. So my focus is on Centre, South West and West directions…..

18 13 11*

19 17* 15*

14 12 16

Mathematically of course this may just be the way these numbers would fall nevertheless it seems worth noting.

The double numbers are associated with well being and positivity so maybe its not surprising that facing it creates a good vibe for us. 

A double number energy is turned inward whereas all the other directions take a different direction outwards. Perhaps its showing us that when we turn inwards on ourselves we may find the answers we are looking for. 

When you draw up the patterns for the double numbers alone they look like a dna ladder turning on an axis………The I Ching is so very simple once you see the patterns x 

Enjoy your thinking. X 

The Other One of The Pair 27th June, 2025

 Another set of 16 from the Game the Other one of the pair…………

Peace enhancing version of the 16 triangles of DNA double sided which contains all 64 codons of DNA> Putting it together is very much a game like Soloman’s Temple because it is your Temple that engages when you fit the pieces together. Some can take days others hours and rarely but possibly within 15 minutes. Remember that what you can see has its polar opposite on the other side of the game because one thing is always attracted by or to another there is no escaping this fact. Enjoy your thinking. X 

The Other One of The Pair as a game of 16 Triangles.

 

I can barely believe it I have managed to make up the game The Other One of the Pair with just 16 triangles…………does that mean I should now work towards getting a count of 32 in the game Soloman’s Temple………oh dear it took decades to get that game from 36 to 34 and now I have to consider the possibility that it can be done in 32. Wish me luck x 

Soloman’s Temple and The Other One of the Pair and their DNA Codons

 

…..example of 34 triangles making up the game Soloman’s Temple……

Example of 17 triangles making up a game of The Other One of The Pair…

More Data please or is that enough for one day x 

The Pairings of DNA Codons

 I noticed this image of the centre eye and thought it seemed familiar to the image above which is the pairing up of DNA Codons and Nine Star Ki Hexagrams reducing 64 to 32……….every connection goes through the centre of the I Ching The Word Plan……….the centre is ALL green tree energy associated with the numbers 3 and 4 but in order to pair up every codon must pass through the centre eye. Is it like a black hole of energy pouring into and out of the centre. Enjoy your thinking x 

Soloman’s Temple and The Other One of The Pair and their Patterns

T meeting A and C meeting G 

          2          8         1          4         3          9          7          6

2 CCC CCT         CTC         CTT         TCC         TCT         TTC        TTT

Read from left to right …

6 GGG GGA GAG GAA AGG AGA AAG       AAA

Read from right to left…

8 CCA CCG CTA         CTG TCA         TCG TTA        TTG

Read from left to right…

7 GGT GGC GAT         GAC AGT         AGC AAT       AAC

Read from right to left…

1 CAC CAT         CGC CGT TAC         TAT         TGC      TGT

Read from left to right…

9 GTG GTA         GCG GCA ATG         ATA         ACG      ACA

Read from right to left…

4 CAA         CAG CGA CGG TAA         TAG         TGA      TGG

read from left to right…

3 GTT         GTC GCT GCC ATT         ATC         ACT      ACC

Read from right to left. 

So when reading left to right the number sequence is…

28143976 but if reading from right to left you also have to read it as 28143976 so in reverse. 

So when looking for pairings for the Game The Other One of The Pair we find them as above. In the usual I Ching Map of The Word based on 28143976 its interesting to note that all eight rows are usually read from left to right but in order to pair them up with their partner number we read left to right then loop back right to left and so on creating a snake like pattern from top to bottom.

1 2 3 7

5

9 6 4 8

Don’t worry too much about the number 5 in this pattern as it does NOT occur here but if required I would change 5 to a number 2. 

The pattern above shows us that if you pick a Nine Star Ki of say:

1/7 TGC that would create its opposite in 9/8 ACG

1 becomes 9 and 7 becomes 8…..T becomes A G becomes C and C becomes G……..all partnering with their opposites. 

In the game Solomans Temple we make a pattern which contains all 64 DNA Codons but in the game with a minimum of 34 triangles. The Other One of the Pair you need only make 32 codons but with the same again on the underside so only 17 triangles are needed. 

The I Ching The Word sequence is…… 2   8   1   4   3   9   7   6 the two outers are 2 and 6 partners… next two 8 and 7, next two 1 and 9 and finally two middle 4 and 3 partners.  So again a clear pattern and reason the numbers appear in this sequence. 

Lets take another example 3/1 ATC partners with 4/9 TAG again each partnering correctly. 

2 8 1 4 3 9 7 6

6 7 9 3 4 1 8 2

Reading 2 8 1 4 from left to right and 6 7  9  3 read from right to left. 

In this pattern TGC is read from left to right and then you turn the circle and read the top line AGC right to left……..fish swimming in opposite directions it can be referred to but infact the moment you draw a circle around the its a different story. 

Enjoy your thinking. X 

Sequences iin DNA Crystals Musically

 Lets take a look at the number count of DNA letters in a Crystal…….

First up the 6/6 - 2/2 Crystal…..

AAAAACACCCCCCCTCTTTTTTTGTGGGGGGGAGAA

There is a pattern here of 5 - 1 - 1 - 7 - 1 - 1 - 7 - 1 - 1 - 7 - 1 - 1 - 2

We see the pattern 1 - 7 because when you get to the end loop it up to the beginning again and you get 7 1 1 7 1 1 7 1 1 7 1 1……….

Lets look at the 1/1 - 9/9 crystal in the same way and see if we can find a pattern there too….

TATATGTGCGCGCGAGATATATACACGCGCGCTCTA

The sequence here is no two letters the same appear in the sequence…….so its 1 - 1 all the way 36 times. 

The 8/4 - 7/3 crystal next…..

TGAGAGAGAGACACACACACTCTCTCTCTGTGTGTG

Again this runs with a pattern of 1 - 1 x 36 no two letters sit alongside each other. 

Double Left Hand side crystal…

TTCTCGCGGGGTGTATAAAAGAGCGCCCCACATATT

Sequence here is 2 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 -1 - 1- 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1 - 1 - 2……but if you loop them the 2 x 2 become a 4 so the pattern here of 4 - 1 - 1 - 1 - 1 - 1 x 4 = 36

Right hand side…

CAAAATATCTCCCCGCGTGTTTTATAGAGGGGCGCA

Sequence here is 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1…….but if you loop last to first you get the pattern here of 1 - 1 - 1 - 1 - 1 - 4 the opposite to the left hand side above. (36 in total)

Diamond crystal…..

TCACAGAGTGTC……..ONLY 12 parts in the diamond crystal……

Pattern here 1 - 1 all the way……….no two letters sit alongside each other. 

How many more patterns can we find in the DNA I Ching crystals. 

Tap out those beats and get another way of looking at your own particular codon and how you relate to other crystals……Left hand and right hand double crystals work together albeit as one beat then 4 beats compared to 4 beats and 1 beat. 1/1 and 8/4 crystals along with the diamond crystal all work to one beat over and over………but the Heavenly crystal 6/6 works alone to the rhythm of 7 and 1 and 1…….enjoy your thinking. X