The Other One of The Pair 27th June, 2025

 Another set of 16 from the Game the Other one of the pair…………

Peace enhancing version of the 16 triangles of DNA double sided which contains all 64 codons of DNA> Putting it together is very much a game like Soloman’s Temple because it is your Temple that engages when you fit the pieces together. Some can take days others hours and rarely but possibly within 15 minutes. Remember that what you can see has its polar opposite on the other side of the game because one thing is always attracted by or to another there is no escaping this fact. Enjoy your thinking. X 

The Other One of The Pair as a game of 16 Triangles.

 

I can barely believe it I have managed to make up the game The Other One of the Pair with just 16 triangles…………does that mean I should now work towards getting a count of 32 in the game Soloman’s Temple………oh dear it took decades to get that game from 36 to 34 and now I have to consider the possibility that it can be done in 32. Wish me luck x 

Soloman’s Temple and The Other One of the Pair and their DNA Codons

 

…..example of 34 triangles making up the game Soloman’s Temple……

Example of 17 triangles making up a game of The Other One of The Pair…

More Data please or is that enough for one day x 

The Pairings of DNA Codons

 I noticed this image of the centre eye and thought it seemed familiar to the image above which is the pairing up of DNA Codons and Nine Star Ki Hexagrams reducing 64 to 32……….every connection goes through the centre of the I Ching The Word Plan……….the centre is ALL green tree energy associated with the numbers 3 and 4 but in order to pair up every codon must pass through the centre eye. Is it like a black hole of energy pouring into and out of the centre. Enjoy your thinking x 

Soloman’s Temple and The Other One of The Pair and their Patterns

T meeting A and C meeting G 

          2          8         1          4         3          9          7          6

2 CCC CCT         CTC         CTT         TCC         TCT         TTC        TTT

Read from left to right …

6 GGG GGA GAG GAA AGG AGA AAG       AAA

Read from right to left…

8 CCA CCG CTA         CTG TCA         TCG TTA        TTG

Read from left to right…

7 GGT GGC GAT         GAC AGT         AGC AAT       AAC

Read from right to left…

1 CAC CAT         CGC CGT TAC         TAT         TGC      TGT

Read from left to right…

9 GTG GTA         GCG GCA ATG         ATA         ACG      ACA

Read from right to left…

4 CAA         CAG CGA CGG TAA         TAG         TGA      TGG

read from left to right…

3 GTT         GTC GCT GCC ATT         ATC         ACT      ACC

Read from right to left. 

So when reading left to right the number sequence is…

28143976 but if reading from right to left you also have to read it as 28143976 so in reverse. 

So when looking for pairings for the Game The Other One of The Pair we find them as above. In the usual I Ching Map of The Word based on 28143976 its interesting to note that all eight rows are usually read from left to right but in order to pair them up with their partner number we read left to right then loop back right to left and so on creating a snake like pattern from top to bottom.

1 2 3 7

5

9 6 4 8

Don’t worry too much about the number 5 in this pattern as it does NOT occur here but if required I would change 5 to a number 2. 

The pattern above shows us that if you pick a Nine Star Ki of say:

1/7 TGC that would create its opposite in 9/8 ACG

1 becomes 9 and 7 becomes 8…..T becomes A G becomes C and C becomes G……..all partnering with their opposites. 

In the game Solomans Temple we make a pattern which contains all 64 DNA Codons but in the game with a minimum of 34 triangles. The Other One of the Pair you need only make 32 codons but with the same again on the underside so only 17 triangles are needed. 

The I Ching The Word sequence is…… 2   8   1   4   3   9   7   6 the two outers are 2 and 6 partners… next two 8 and 7, next two 1 and 9 and finally two middle 4 and 3 partners.  So again a clear pattern and reason the numbers appear in this sequence. 

Lets take another example 3/1 ATC partners with 4/9 TAG again each partnering correctly. 

2 8 1 4 3 9 7 6

6 7 9 3 4 1 8 2

Reading 2 8 1 4 from left to right and 6 7  9  3 read from right to left. 

In this pattern TGC is read from left to right and then you turn the circle and read the top line AGC right to left……..fish swimming in opposite directions it can be referred to but infact the moment you draw a circle around the its a different story. 

Enjoy your thinking. X 

Sequences iin DNA Crystals Musically

 Lets take a look at the number count of DNA letters in a Crystal…….

First up the 6/6 - 2/2 Crystal…..

AAAAACACCCCCCCTCTTTTTTTGTGGGGGGGAGAA

There is a pattern here of 5 - 1 - 1 - 7 - 1 - 1 - 7 - 1 - 1 - 7 - 1 - 1 - 2

We see the pattern 1 - 7 because when you get to the end loop it up to the beginning again and you get 7 1 1 7 1 1 7 1 1 7 1 1……….

Lets look at the 1/1 - 9/9 crystal in the same way and see if we can find a pattern there too….

TATATGTGCGCGCGAGATATATACACGCGCGCTCTA

The sequence here is no two letters the same appear in the sequence…….so its 1 - 1 all the way 36 times. 

The 8/4 - 7/3 crystal next…..

TGAGAGAGAGACACACACACTCTCTCTCTGTGTGTG

Again this runs with a pattern of 1 - 1 x 36 no two letters sit alongside each other. 

Double Left Hand side crystal…

TTCTCGCGGGGTGTATAAAAGAGCGCCCCACATATT

Sequence here is 2 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 -1 - 1- 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1 - 1 - 2……but if you loop them the 2 x 2 become a 4 so the pattern here of 4 - 1 - 1 - 1 - 1 - 1 x 4 = 36

Right hand side…

CAAAATATCTCCCCGCGTGTTTTATAGAGGGGCGCA

Sequence here is 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1 - 1 - 4 - 1 - 1 - 1 - 1…….but if you loop last to first you get the pattern here of 1 - 1 - 1 - 1 - 1 - 4 the opposite to the left hand side above. (36 in total)

Diamond crystal…..

TCACAGAGTGTC……..ONLY 12 parts in the diamond crystal……

Pattern here 1 - 1 all the way……….no two letters sit alongside each other. 

How many more patterns can we find in the DNA I Ching crystals. 

Tap out those beats and get another way of looking at your own particular codon and how you relate to other crystals……Left hand and right hand double crystals work together albeit as one beat then 4 beats compared to 4 beats and 1 beat. 1/1 and 8/4 crystals along with the diamond crystal all work to one beat over and over………but the Heavenly crystal 6/6 works alone to the rhythm of 7 and 1 and 1…….enjoy your thinking. X 

The Other One of The Pair in Soloman’s Temple of 17

 At last I have managed to do the game The Other One of The Pair as a set of 17. As the least I have been able to create in the Solomon’s Temple game is 34 then I knew it must be possible to get this game down to 17 and I have done so here. I still think 34 an unusual number for Soloman’s Temple and when it was 36 it seemed so right because there are 36 letters in a DNA I Ching Crystal and yet I have got it down to 34 which makes me wonder if perhaps a 32 is possible. Time will tell. It took me 12 years to get the 36 down to a 34 so if it is possible lets hope I can achieve that in less that 12 years. Enjoy your thinking. 

This is The Other one of the pair where we create a game like Soloman's Temple but instead of seeing all 34 codons in front of you half of them are to the rear of the pattern. Imagine the triangles are on a piece of glass that you can see the underneath of …….then you will have all 64 codons of DNA in just 34 for Soloman’s or 17 for The Other One of the Pair. 

The Half game of Soloman’s Temple a.k.a. The Other One of The Pair

 

Here we see a game of 20 triangles which create all 64 DNA codons as any missing can be found on the reverse side of the pattern just as we see one side of a string of DNA. To make a game of 20 it has used 5 partial hexagrams instead of 6 pieces each hexagram has only 5 pieces. 

In order to reduce the game to its minimum (so far) of 18 we can adapt and end up with a full six piece hexagram as well as the fives. 

Now we have managed to reduce the game down to 18 pieces with one 6 piece and 3 5 piece Hexagrams. 

The game has yet to be officially named……..a game of two halves came to mind but I am currently settling on The Other One of the Pair……..a more scientific angle to it. Enjoy your thinking. X 

Soloman’s Temple as a Game of Two Halves with 18 pieces

 I wonder what I should call this part of The Soloman’s Temple game………A game of two halves perhaps …………If I can make a game of Soloman’s Temple with the reduced number of triangles to 34 then I should be able to make this game from 17 triangles but so far 18 seems to be the least, I will persist though. In The I Ching etc., when you know half the story you can guess the other side so perhaps this game is just more of the same. Soloman’s Gam of Two Halves is the name I will stick to for now. Enjoy your thinking. X 

All 64 Codons of DNA can be found in looking at both sides of this pattern. Imagine it is between two sheets of glass and you can turn in over. Then you have every codon required. X

Solomans Temple in its most Reduced Form

Well those of you who are familiar with Soloman's Temple as a game of 34 triangles that make up all the patterns of DNA then this may come as no surprise but having made some other triangles with two sides in different colours it occurred to me that a pattern of less triangles could be used to create all 64 DNA Codons within its pattern. This is new to me and I have managed to make up a game this morning that consists of 20 triangles. The pattern seen can be imagined as floating in space so as it turns you see the other side and thus in just 20 triangles with two sides you can reproduce all 64 DNA Codons that exist. Life just keeps on getting smaller. lol. Enjoy your thinking. x

I guess if you use a magnifying class to look at small things you might be able to see they could be smaller and vice versa, you seek out a planet and end up finding a Universe. We we one day manage to create everything from even less. X