Map 90 Expanded and Restricted DNA

DNA in Jupiter and Saturn Mode

These images are of DNA expanding outwards into a crystal forming 12 three letter codons. The Larger one to the left is the Jupiter or expanded version. The smaller one is the Saturn or restricted version.

As you can see the far left strip works as follow:

TTATAGAGGGGCGCACAAAATATCTCCCCGCGTGTTTTA

                                     TTAGGCAATCCGTTA

If you look closely at the first three letters TTA then drop the first letter but copy the second and third then take the T which you dropped and working from the template of DNA working clockwise go the the next letter after T which is G so now we have TTATAG then add the last two letters again using the first dropped letter again a T and moving it clockwise gives you a G so now we have TTATAGAGG continue this way until you find yourself back at TTA all over again. This should be 39 letters but its really only 36 the last three are just letting you know you have got it right.

This is the Jupiter expanded view.

 

Then as you can see on the shorter row TTA letters two and three TA get repeated so instead of doing the repeats just add the letter that comes third which you make from the first letter which you move up one from the template of clockwise DNA.

So you can give the full string of DNA (Jupiter) or you can shorten it (Saturn) to just 14 letters.

 T = Orange G = Yellow A = Green C = Blue

A necklace with its matching bracelet.