Map 802 Birthcharts built from DNA and Nine Star Ki

Perhaps the five variations of crystals give us five variations of man. The 6/6 crystal, the 1/1, 8/4, the double largest crystal and finally the diamond smallest crystal. 6/6 and 1/1 have a relationship, the double relates to its own other half and the 8/4 and diamond crystal are attracted to each other.

So next time you set up a birth chart just remember you need to find out which crystal you belong to before you start adding those planets, or opportunities for mutation and change.

So people born with the DNA letters that belong to the 6/6 crystal above would use this as their template. First house AAA, a year number 6 born in February, May or  November. Interestingly AAA produces 6/5 and as five does not exist in The I Ching world it is changed to either a 2 AAA or 8 AAG. Perhaps not the best example to have chosen but it is what it is. So only males can become AAA which is not something I had previously given any thought to.

Other DNA codons in the 6/6 crystal would be 6/6, 4/6, 8/6, 2/6, 2/4, 2/8, 2/2, 3/2, 7/2, 6/2, 6/3, 6/7,  all of which could be added to the template above. CCC would be the 4th house, TTT would be the 7th house and GGG would be the 10th house. No surprise their that the Heavenly energy of GGG would belong to the house of the C.E.O. (Chief Executive Officer).

Now we look for the same information in the 1/1 crystal.  The first house is now TAT which belongs to someone born in a 1 year during October a Nine star ki of 1/9/6. So We can see that TAT has a connection to AAA only because they both belong to the first houses of their templates. Others with the following nine star ki numbers would belong to this crystal. 1/1, 9/8, 1/3, 9/1, 7/9, 4/1, 9/9, 1/7, 9/4, 1/9, 8/1 and 3/9.

So First house TAT, 4th house GCG, 7th house ATA and finally 10th house CGC.

Now we can see that to start your birth chart you need to know which chart you belong to. The same rules apply to the other crystals which you can trace the DNA letters of via previous maps. For me my chart template is the 1/1 crystal above.

Template of the 1/1 Crystal

My birth Chart for 1/7/8

15^th, March, 1954

1^st house – TAT – 1/9 – 64 Hexagram

2^nd house – ATG – 9/4 + 37 Hexagram

3^rd house – TGC – 1/7 + 47 Hexagram

4^th house – GCG – 9/9 - 30 Hexagram

5^th house – CGA – 4/1 – 48 Hexagram

6^th house – GAT – 7/9 – 38 Hexagram

7^th house – ATA – 9/1 + 63 Hexagram

8^th house – TAC – 1/3 – 40 Hexagram

9^th house – ACG – 9/8 – 22 Hexagram

10^th house – CGC – 1/1 + 29 Hexagram

11^th house – GCT – 3/9 + 21 Hexagram

12^th house – GCT – 3/9 + 21 Hexagram

So each section gives you a three letter codon. Take the 1^st house of TAT and then look at the three outer, middle and inner rings of the circle and you will see that TAT runs through them too. In fact all the 12 codons repeat themselves over and over again throughout the template.

So my TGC belongs to the 3^rd house but can also be found in the outer edge of the 3^rd, 4^th and 5^th houses, the 2^nd, 3^rd and 4^th of the middle circle and in the 1^st, 2^nd and 3^rd houses of the inner circle.

Four different representations of TGC within one circle but all active between the 1^st, 2^nd, 3^rd, 4^th and 5^th houses. The dominant one is at the centre or in the 3^rd house.

1 2 3 4 5

All working between the 1^st and 2^nd quadrants. So these must be more dominant for me.

Within those first five houses there are 4 fire T symbols, 3 earth A symbols, 5 G air/tree symbols and 3 C water symbols. So air/tree dominates G, followed by fire T and a joint count of 3 for water and earth.

The above are the positions of the sun signs with Aries as the starting point at house one. The usual house positions need not apply here. So the planets above would be positioned in the codons that apply to this particular crystal.

I have Venus in my 1^st house, empty house 2^nd, Jupiter 3^rd house, Uranus 4^th house and Moon in 5^th house. So I suspect they will be important to me as they all have some connection with my TGC. Clearly the most important planet is Jupiter as it is in the 3^rd house of TGC.

So the first TGC is very close to the centre and smaller in size as it spans the 1^st, 2^nd and 3^rd house.

It becomes marginally more prominent as it spans the middle circle TGC across houses 2,3 and 4.

TGC that is on the outer circle is the biggest and most dominant as it spans houses 3,4 and 5. So whilst Venus is strong in the first my most dominant planets are Jupiter, Uranus and the Moon. Don't forget that TGC spans the whole of the 3^rd house so without a doubt Jupiter is the most prominent of all. For that I have always been grateful. No time for boredom as another idea will be along in a moment. I think this blog tells you a lot about what you need to know about me and my dominant features.

Map 801 Nine Star Ki Variations

Variations on a Theme of Nine Star Ki

 

 

If they cuddle up together they can save space into infinity and beyond. Happy New Year. 

Map 800 DNA Bases and Their colours

Having watched the Royal Institute Christmas Lectures I make the following observations:

Astrology and DNA

I cant help but wonder how the colours of the bases of DNA in science became as follows:

T – Thymine – Yellow – Fire

G – Guanine – Green – Air/Tree

A – Adenine – Blue - Earth

C – Cytosine – Orange Red - Water

I find it hard to believe that the colours above match well with the elements they represent. I know science tries its hardest to stay away from astrology and its elements of Fire, Earth, Air and Water but is this a deliberate distraction.

For me the following fits much better:

T – Thymine – Orange – Fire

G – Guanine – Yellow – Air/Tree

A – Adenine – Green – Earth

C – Cytosine – Blue – Water

 This is an image of the 6/6 Crystal as a wheel or astrology type chart:

It shows how in area one, Earth, some of it is still coming from the past yellow area (air) and some is moving into the future blue area (water). In this particular case the 6/6 crystal is very neat and orderly as one would expect of Heavenly energy but if we look at the next one the 1/1 crystal is now much more dispersed that the 6/6.

 

The 1/1 crystal has now spread itself about more. My own DNA reference TGC can be seen in the 3rd house of communications.
So I think not to connect, Astrology with the I Ching and The I Ching with DNA, and DNA with Nine Star Ki and so on would be a missed opportunity.
In particular in the cases of different base codes which make the same amino acid e.g. CCC and CCT both make Proline.
With more choices CCC can also be described as Proline... Hexagram number 2...Hexagram word Earth...musical tones D# G B... Nine star Ki 2/2... Position centre... Binary 000000... Element Earth/Earth... Planets Saturn/Saturn... Shape Grand Trine in Water... Houses and signs Cancer 4th, Scorpio 8th, Pisces 12th...I Ching Lines Jin, Jin, Jin, Jin, Jin, Jin...belongs to the 6/6 Crystal in the IC bottom peak position...First C Cancer chest...second C Sexual organs...third C feet.
Now the same amino acid must be different in some way and CCT makes Proline...Hex number 23...Hexagram Words Strip Away...musical tones D# G G#...Nine Star Ki 2/8...NE sitting SW facing position...Binary 000001...Element Earth/Earth...Planets Saturn/Saturn... Shape 120* x 30* x 150*... Houses Cancer 4th - Scorpio 8th...Sagittarius 9th...I Ching Lines Jin, Jin, Jin, Jin, Jin, Jang...belongs to the 6/6 crystal in the 5th house position... First C chest...second C Sexual organs... third T Liver.
So they both make Proline but they have differences which could mean they make Proline in a specific area of the body. CCT moving to the Liver whilst CCC heading for the feet. All food for thought and as much thought as we can muster is the best so please don't discount the old ways in favour of the new which in a lot of cases has come via spiritual routes. If looking at The I Ching can produce over 800 blog pages it has to be worth a peek.

If not looking at astrology is something you like to mention then you are no Einstein.  Enjoy your thoughts. x

Map 799 Amino Acids and their communications

Good morning I thought I should communicate with you in a DNA manner and thus have left you the following message.

CACGCCCCCCCTTACTAAAACGAATGGTAGTATGAGGCTAGATGA

If you cannot fathom it try Map 14 for a little help. x

Map 798 36 Triangles of Solo Man's Temple for December, 2013

Solo Man's Temple for December, 2013

I know I said I wouldn't list another 36 Triangles but it is Christmas and I love doing it so much.

This is a game whereby all 64 codons of DNA can be read in the pattern of 36 triangles. Of course there can be more than 36 triangles but I have found the lowest amount of triangles that can contain all 64 codons hidden amongst it to be 36.

Give it a try you will soon be hooked. As you don't have the game you can either make one on your word program from colored triangles or just write down the letters of the colours T for Orange G for Yellow A for Green and C for Water. Or use a felt tip pen to colour in the shapes.

When you think you have included all DNA count up your triangles and then try to reduce them down to 36.  Then check them against the list below as is often the case you may find you have used the same letters twice and will have to amend it.  Good luck and enjoy and Merry Christmas x 

 

CCC CCT CTC CTT TCT TTT

CCA CCG CTA CTG TCA TCG TTA TTG

CAC CAT CGC CGT TAT TGT

 CAA CAG CGA CGG TAA TAG TGA TGG

ACA ACG ATA ATG GCG GTG

AAA AAG AGA AGG GAG GGG

This is the 64 codons reduced taking out any that read the same backwards e.g. CGT is in but TGC is not. 

Of all the thoughts I have had over the years this one is my most perfect. I can pick it up and meditate my way through it anytime the fancy takes me. I hope you enjoy it too. x

Map 797 The Laws of Attraction

Life and its Opposites

The very act of observation creates a bridge or a relationship between the observer and the observed. It is called spooky action from a distance. How very scientific ! Try to imagine something that is strong in your hearts desire and bridge that gap.

The image of the bridge above looks remarkably like the symbol for Libra which is all about relationships. Once you start to think about your hearts desire a connection forms and the more you think about it the stronger that connection becomes. One particle has become connected to another particle. I also believe that in some cases our DNA is encoded to want to attract certain things into our lives. These particles are encoded to react together even when separated and in ways hidden from us. So perhaps out desires are born with us, not in all cases, e.g. a cream cake, but in major ways certainly. We are also capable of attracting anything and everything in our direction but perhaps its easier to attract those things that are encoded in us from birth.

So we have the bar of attraction or the bridge between them and particle A is turning clockwise and particle B is turning anticlockwise. Having said that if I am standing in position A looking towards B that's true but if I am standing in position B and looking towards A then I realise that B is now clockwise and A anticlockwise. So although they appear to being moving in opposite directions are they in fact doing exactly the same rather than the opposite.

If you consider the bridge to be like a piece of studding. A threaded metal bar we can see from the item above they are in balanced and harmonious positions to each other on the bar. In the studding image below we can see that both hexagonal nuts have moved to one end of the bar and that does not bode well for balance and harmony. Interesting that a nut is hexagonal, it doesn't need to be.

The higher the vibrational connection you have to your hearts desire the better your chances are of succeeding in attracting this into your life. The strength of the vibrational essence of your desire opens up pathways and if you take the path of least resistance your journey will be made easier. If your journey is from A to B then it could be unbalanced and less harmonious even if you get results but if A moves towards B with the same strength as B moves towards A then they meet in the middle and this is a more balanced and centred meeting point.The half way house.

Remember if your not feeling it, its not going to happen. The stronger your feelings the more likely you are to attract into your life all that you desire. Desire follows will, as Deepak Chopra says, “it has no choice”. Feel it, get that sense of anticipation you get when something new is about to happen. Your vibration is poetry in motion, with the right strength your new vibrations are matching up to their opposite particle and in every moment your desires can come alive. Desires are in constant search for a heart that is willing to yearn for them. “It” is already out there you just need to find the light and see it.

Passion finds desire and together they are manifest. The way you see your life is the way it will turn out. So don't start complaining when things aren't what you would like them to be.  Do something about it and change your world for the better. Merry Christmas. x

Map 796 The I Ching Chess Set

Just a few examples of 1/7 ..... 7/9 ..... 7/2 ..... 2/2 .....

What shape do you make how much of the board do you cover.

I wonder what to make of the King 2/3 and 6/4 and the Queen 2/4 and 6/3?

Myself I am in the open board position.

Map 795 Blanket by Suzanne Sharp at The Rug Company

This is the sort of design you can do when you change thinking into art work. This beautiful rug is DNA all over, The Hexagrams all over, Nine Star Ki and so on. Simply lovely and useful unlike some of my random thoughts.

Map 794 The First 24 Hexagrams and their Elements

This is the first batch of 8 hexagrams. The hexagrams are made up from and 8 x 8 grid which creates 64 different codons so I think examining them in groups of 8 is a good idea.

We can see that the most common element comes from the letter C Water with 5 upward pointing triangles and 4 downward pointing triangles. Fire has 4 up and 1 down with earth being the opposite with 1 up and 4 down. G has 2 up and 3 down just 5 tree/air element triangles which is puzzling since this is the starting point of the hexagrams and GGG is all tree/air. So this count shows us Water dominates in the first 8 hexagrams and all other elements are equal.

Now for the second batch of 8:

This is the second batch of 8 hexagrams. The hexagrams are made up from and 8 x 8 grid which creates 64 different codons so I think examining them in groups of 8 is a good idea.

We can see that the most common element comes from the letter G Tree/Air with 4 upward pointing triangles and 4 downward pointing triangles. Fire/T has 5 up and 1 down with earth being the opposite with 1 up and 5 down, C/Water has 2 up and 2 down and is the smallest element here.

So Tree/Air/T dominates and Water/C is the weakest.

Batch 3:

This is the third batch of 8 hexagrams. The hexagrams are made up from and 8 x 8 grid which creates 64 different codons so I think examining them in groups of 8 is a good idea.

We can see that the most common element comes from the letter C Water with 5 upward pointing triangles and 5 downward pointing triangles. Fire/T has 2 up and 3 down with earth being the opposite with 3 up and 2 down, G Tree/Air has 2 up and 2 down and is the smallest element here.

So Water C dominates and G Tree/Air is the weakest.

 

Map 793 The Pyramids as DNA Hexagrams

Similarities?

Or just the same message?

Whatever floats your boat.

I guess this boat could be called Unity the Heavenly energy of GGG before it decides to create Earth.