DNA Codons - GAG - GTG Sickle Cell Anemia and CAG Huntingtons Disease.

 Sickle cell anemia is an error on the DNA GAG - GTG swopped……

GAG produces Glutamic Acid Hex 14 Nine Star Ki 6/9  Metal controlled by Fire hydrophilic likes water

GTG produces Valine Hex 13 Nine Star Ki 9/6 Fire destructive of Metal - hydrophobic does not blend with water

A disorder promoting Glutamic Acid is swopped for an order promoting Valine. 

The letter G does not change first G is associated with Gemini the third house and the Central Nervous System and the third G is about Aquarius the 11th house and circulation. The middle T is associated with the Heart and Spine Leo and the 5th house…..whereas middle A is associated with Intestines Virgo and the 6th house. 

Hydrophilic or Polar attracts water molecules and Hydrophobic or None Polar does not interact with water molecules. The repulsive force of surrounding water molecules act to force phobic regions toward other phobic regions hydrophilics push them away. These interactions are the foundation for the existence of life. 

Glutamic Acid transmits to the brain via the nerve cells so how does Valine change that ….an abnormal hemoglobin in which Valine has been replaced by Glutamic Acid causing the hemoglobin to become less soluble under decreasing oxygen concentrations and to polymerize into crystals that distort the red blood cells into a sickle shape. 

G        C                                        G        C

A        T                                        T        A

G        C   CTC is 2/1 Leucine     G        C      CAC is 1/2 Hex 7  Histidine

When we mention GAG we fail to mention the opposite side of the string which is CTC and Leucine and for GTG the opposite side is CAC and Histidine……….they must come into play at some point.

Notice all four codons are palindromes………..

CAG Huntingtons Disease…..

CAG is a condition where the Codon CAG repeats if it goes over 36 repeats it can cause Huntingtons Disease . CAG Glutamine Hex 18 Nine star ki 4/8 is the shadow side of the GTC Valine Hex 17 3/7 cube. So it creates an ALERT as 4/8 and 3/7 do not happily partner each other. They do pair up from the Hexagram perspective though. In both the crystals and in strings of DNA GTC is created which is unusual in itself. CAG is hydrophilic and GTC is hydrophobic. 

This is the record of Life which shows the CAG Codon fits at the centre in the smaller diamond crystal. I wonder if the fact that the diamond crystal has just four codons might mean it repeats itself over and over trying to fill the usual 12 codons found in a crystal. A crazy view is also when you play this record and the arm moves to the centre unless you remove it it continues to repeat itself over and over again. Just a thought random as it is. 

CAG is musically played at D# 1st Water Sign Cancer 311.13Hz -  A Second Earth sign Virgo 349.23 hz - G third Air/tree sign Aquarius 466.16 hz

GAG is musically played at G Air/Tree 1st Air sign Gemini 293.66 hz - A second Earth sign Virgo 349.23hz - G third Air/tree sign Aquarius 466.16hz

GTG is musically played at D Air/tree 1st Air sign Gemini 293.66 hz - T second Fire sign Leo played at E 329.63 Hz - G third Air/tree sign Aquarius 466.16 Hz

More DATA please I do hope someone out there will piece this all together and find something more to add to this list of data and find answers to many questions about DNA. Enjoy your thinking x 

How to Create a DNA Crystal Through The I Ching

How do we create a Hexagram based crystal …….crystals have 12 codons in the 6/6 - 1/1 - 8/4 crystals, then we have the double crystal which contains 24 codons and finally the Diamond crystal which has just four codons.

You can use coins Heads is a Jang Line and Tails a Jin line………this will form a Nine Star Ki I Ching Hexagram set of six lines which in turn can be turned into a DNA codon. You can throw a dice with four sides each holding the letters T G A C and as they land you can use those letters as your first codon. Whichever your choice Nine Star Ki lines, Hexagram Numbers, DNA letters you will be able to continue from that one code to create the 12 in that pattern. In some ways it is wise to know all of the choices…..

Hexagram Number…Nine Star Ki Numbers…DNA Codon… Amino Acids…Phobic or Philic…directions…which crystal it belongs to…Musical Notes… Planets…Aspect shape…measurements… all of which will help you see when you have made an error or that all your measurements are correct. The more data the more chance of spotting an error. 

So lets look at someone who throws the coins to create lines…….Jin, Jang, Jin, Jang, Jang, Jin …

___ ___

_______

_______

___ ___    1/7 Nine Star Ki Lines Hex 47 Cysteine NE/SW 1/1 crystal C F# B 

_______   Mercury Venus 180 x 150 x 30 Ruminator Phobic 

___ ___

TGC GCG CGA GAT ATA TAC ACG CGC GCT CTA TAT ATG ……and then it will return to TGC…. if you have more than 12 codons before returning to the original letters you have gone wrong. 

To create all 12 codons you need the window of letters to work with…moving in a clockwise direction…

Take TGC…..repeat the last two letters GC and then take the first letter T and move it clockwise one square around the above image… now you have TGC - GCG and so on carry on this way until you eventually return to TGC……all crystals work in this same manner. 

6/6 - 2/2 are the peaks of this crystal and you can start anywhere but 6/6 is GGG next step is GGA etc.,

9/9 - 1/1 are the peacks of this crystal and you can start anywhere but 9/9 is GCG next step CGA etc.,

8/4 - 7/3 are the peacks of this crystal and you can start anywhere but 8/4 is CTG next step TGT etc.,

Double crystals start with TAG  4/9 next step AGG and CGG 4/4 next step GGT for many reasons which you can see with hexagrams most clearly these two want to be combined.

Finally the Diamond crystal is just four codons - TCA next step CAG - AGT - GTC …..it can be no coincidence that no matter which codon you choose to start this formation all 64 codons are contained within these 6 variations on a crystal it is compact and complete and works. It must have some form of meaning for DNA codes. 

All the Crystals in DNA I Ching

 Looking at the patterns you can make from the crystals I observe the following…..

6/6 - 2/2 Crystal…

1/1 - 9/9 Crystal…

Observe the patterns the letters of DNA create G yellow - A  Earth - C Water - T Fire…

Lets connect the colours diagonally now….

Very similar except all colours group together in the 6/6 crystal whereas here in the 1/1 we see they are singular lines …

They can connect even more….as pairs…

Very much a diagonal connection with this pairing. 

Then we see the pairings of the 8/4 - 7/3 crystal and The Diamond Crystal…the Diamond crystal contains only four codons does it remain just four or does it repeat itself three more times to create a 12 piece set of the crystal…….it could explain the desire for CAG to keep repeating in Huntingtons disease…

and finally the pairings of the double crystal……..first image shows the dna double crystal in its usual form…

The green lines denote the way the crystal usually pairs up the two centre rows as a pair but oddly in this form of drawing the double crystal it pairs up differently in order to work the same way the other crystals have one blue line version and one red line version……..

So if we change the set up the lines work the same way…….lets see what happens to those lines if they have to sit the way they do in the double crystals original pattern…

So we see here an error we cannot connect three on the right hand side of the crystal …line CCA does not fit in and should read CCC in order to conform but CCC belongs to the 6.6 crystal and not the double. The Double looks like a twin peak church maybe we better pray we can find out why errors occur when we least expect it. 

So diagonal lines connecting three letters the same seems to be the order of the day with Crystals in all except the last version…..does it tell us to use the other version of the double maybe….but if we do they do not match the Hexagram positions……..there is always something that just doesn’t conform. Alerts and errors occur in all places. We are our mutations its what makes us special and unique. x

The Crystals in Lines of Colour with Nine Star Ki

 The 6/6 crystal in coloured lines of Nine Star Ki……..

The 1/1 Crystal in coloured lines of Nine Star Ki…….

Perhaps the spiral of DNA Crystals of the I Ching are created more simply by the cross of Nine Star Ki lines…………1 Blue…2 Yellow…3 Light green…4 Dark Green….6 Grey…. 7 Red…. 8 Orange…. 9 Purple….

The Colours of The I Ching

 Goethe’s Colour wheel……

I couldn’t help but see that this ring is strongly connected to DNA Codons……

….and also to Windows although this too is a map for DNA read clockwise for DNA and anticlockwise for RNA….

As we can see here we start in the East with green A then blue C Orange T and Yellow G the colours showing the maximum colour in one quadrant of DNA…….C Water…T Fire…G Air/tree…A Earth or simply colours. So many ways to portray things in life all 64 codons appear in this record of life and they also play musical tones of three letters…….a record seems like a good way to display them. X 

The Energy of June, 2021 in Various forms

                                   The Energy in June, 2021 6-1 

        5-9 (2)            1-5 (8)            3-7

February         October          December

TCT                CAT                GTC

Thinker           Teacher         Teacher

4-8                 6-1                8-3

January       March/June    August/May

CAG                AGA             TCA

Magician        Lecturer        Teacher

9-4                    2-6                7-2

September    November      April/July

ATG                  TTT            AAC

Worker         Grand Trine    Alternator

5-9 is shown here as 5-2 but it could also be 5-8 in 

A female chart 8-9 TCG

1-5 is shown here as 1-8 but it could also be 1-2 in 

A male chart 1-2 CAC 

Choice is yours here. I find the letters of DNA can 

Sometimes help with that decision as 5-9 (5-2) TCT

Is the opposite to AGA the centre DNA code and 

CAT 1-5 (1-8) is the opposite to ATG so I chose 

These two in this map for this reason. 

            8 C        10 T

            13 A        5 G

There are 12 months in a year so three of the 

Codons repeat twice giving a dominance to A 

Earth energy and T Fire energy. Aspect shape wise

The Teacher dominates with 4 months October, 

December, August and May. 

The priority energy though comes from the centre

And is 1-6 energy AGA …….I always imagine a 

Cosy kitchen scene when I think of this DNA codon. 

The aspect shape is The Lecturer here and big life

Lessons must be taught ……notice also in the image

Below that 6/1 is at the centre 1 is in the South and 6 is

In the North denoting that the energy is sitting in the

North facing South.

The Movement of Crystals in The I Ching

 

The Aspects in all Shapes and Sizes in Astrology - I Ching

If you place the shape within a circle it has 72* between each point...

if you measure the inner angles on each point it measures 108*.....72* is all about creativity and 108* is all about enlightenment. Are 72* angles all about baby steps, the more you learn the closer to

enlightenment you become. 72* is the minor to the 108* major.108* is expressing life as joyful, carefree and fun, dancing in the moment with no signs of self consciousness. 72* is more creative and perhaps you still concern yourself with what others might think of your work. 108* is portrayed as dancing and musical instruments with beauty and romance portraying an exciting colourful world in which you live. What more could be asked of us. Is that why so many ancient cultures around the world dance to this day at ceremonies. We westerners of course feel very self conscious when watching them and

feel the desire to laugh but there is no doubting they are dancing free from our judgements and lack of ability to set ourselves free. Life is more vibrant around people with 108* aspects in their lives. I would

use the Dogons as an example of free dance here because they have so much more to tell us than dance if we look at the style of their dress we might also see the pattern for plasma hidden in the ceremony. Ancient cultures seem to have much longer memories than we westerners I wonder why that is. Are they the ones that have survived catastrophe in the past and continued the race after flood, wars etc., 

Is life plasma electric like the Hadron collider........a sperm penetrating the egg creating a God particle......us. Look at Shiva which is described as he but for some reason to me seems like a she or is that part of the point she or he there is no separation. Shiva does her dance beautifully outside of CERN where the large hadron collider can be found. Shiva dances the dance of creativity associated with 72* but becomes so joyful that she moves into the joyful expression of 108*........is 72* living life and reaching its peak at 108* thus creation can only be followed by destruction. Shiva is the Lord of the Dance of Venus 72* creation and Pluto 108* transformation.......at some time we are composed to dance the dance of our lives only to follow that by becoming compost. Creation and destruction is life itself. No point in wasting our 72* moments as collectively they become our 108* dance and if upon reaching that transformative point our dance is not free and without self consciousness then we will return to dance once more........eventually we will be The Lord of the Dance and our transformation can take place........we don't necessarily have to die at this point but we will in true Pluto style have been transformed. We can improve with every use of the 72* of creativity...there are five 72* opportunities and through those aspects we become more than that 72* aspect we raise our tone up by half a tone 72 + (1/2) 36 = 108*  still using music as an example take C plus half a tone........our tune is now playing to C# we have raised our tone. How else might we portray ourselves now that we have raised our game......could we have an aura of light around us now that makes us more apparent to others whilst it remains invisible. The more cloaks of light from the raised tones we collect along our journey the closer we become to being an enlightened spirit of 108*. We have all met people that just seem to  attract our attention and brighten our lives. We all have this opportunity, no one person is more likely to be able to cover ourselves in veils than another...... go forth and be the light of the world. The 64 codons of DNA (or the I Ching) are called light bearers..........so we are all born equal it is up to us to raise the tone, colour, or light in our lives.  Venus and Pluto working together throughout our  lives so when things seem to have been destroyed this might also be an opportunity for change to set you back on the right path of light. Have fun and dance freely leave self consciousness for other less enlightened souls. 72* A Happy and Productive aspect working well . I am sure this shape within buildings across the world are chosen for this very reason.  Oh to be an Architect....what joy x 

108* can be 72* + 36* or 1.1/2 times 72* .............108* the degree of enlightenment.  There are 108 beads on Mother Mary's Rosary, 108 Earthly Temptations in life, 108 steps up to the Temple......108* is the gift of awareness or a serendipitous way of bringing things together at the right time.... I like the idea that Mother Mary may be involved in our most serendipitous moments. 72* is all about how unique you are but 108* is the best way to compliment that with the gift of enlightenment.  So many times we might think we are becoming enlightened only to find ourselves back at the bottom of the steps to the Temple once more..........but these shapes and aspects come up for us over and over again........be ready for them and make the most of them. Check your own birth charts for these measurements and also by transit. 9 x 12 = 108* or all 12 stations of the Cross. There might be some hard work involved with the journey but it will be worthwhile when you reach your destination and Mother Mary will be with you throughout.  We know through music we can raise or lower our DNA by 1/2 a tone so too can we improve on what we have in the birth chart 72* + 36* (half) = 108* So The Enlightenment aspect of 108* is the raised level of the 72* aspect of your own uniqueness. Go forth and shine as bright as you can. 

As you can see from most of the maps on this blog you only need to be able to see one half of a map to guess what is going to be in the other half. I think that’s why the opposition aspect can be challenging but it also sees more of what is going on or has more knowledge of the matter in hand to be able to sort it out. Unlike the square which is still challenging but doesn't have so much vision.

The Quincunx which features large in my chart is all about making changes when you see things are not working out the way they ought. They can be confusing because your best intentions are not received the way you meant them to be so adapting is difficult because you need to be adapting to suit you and your life not to suit others. Getting a handle on the adaptations is what this is all about and let's face it adaptations are usually about improvements and making something better than it was before. Its very much about the clashing elements with this Trine aspect, all about a talent you have in life, one that the world cannot fail to see so long as you can be bothered to use it. Latent talent is wasted talent. Use it or the world loses it.

The sesquiquadrate is an energy that can be released through hard work. Bottled up it wont be so good but released in a positive manner and it will work well for you.135*

The Enlightenment aspect again I would love to call this Solo Man's Temple because something is going on here that brings awareness and light to the world. Love love love this aspect despite its potential for clashes it can also just about straddle three houses e.g. Pisces to Cancer can be 108* but so can Aries and Cancer and this will play out very differently but still it brings awareness.

Square aspect is so jam packed with energy you can always get done what is required of you, unless you are just plain lazy, then it may work against you. That said overdoing it can cause exhaustion and then nothing gets done so you are very active but need to rest too.

Quintile 72* another of my favourites this is all about creative output, getting your thoughts and ideas out there.

Sextile 60* is a small talent a growing talent. One that you will be working hard to make something of. This is not like the full grown talent that has become a lazy bones this is an energy that really wants to show itself and with luck it should do just that.

The Wisdom aspect is a division of the chart by lucky 7. 51.45* So if your a lucky person you may well acquire wisdom along the way. Make sure its true wisdom though and not just because you are a lucky soul. So when a man has been hungry all his life and you want to spout wisdom at him you may not get the response you thought. Avoid condescension not everyone has been quite so lucky.

Semi – square 45* this is less powerful than the square and can bring its own conflicts but will give you the energy to deal with them potentially more gently.

Semi-quintile 36* still a creative thinking energy but can sometimes be a clash between two elements, So adjustments will be required. Forms part of a data bank. 

Semi-sextile 30* food for thought a small idea that can grow, a seed of Semi-quintile still a creative thinking energy but can sometimes be a clash between two elements, So adjustments will be required. Forms part of a data bank. Semi-sextile food for thought a small idea that can grow, a seed of potential.

Conjunction is a combination of energies and if they do not have a clash of the planets the combination will have added strength. If you put a biscuit next to an onion in the fridge you might get an onion flavoured biscuit. Not everybody's cup of tea. Learning to love your combinations is what will make your combination energies work at their best. An onion flavoured biscuit would be nice with soup for example. This is your own blend. If it's happening embrace it.

So a little look at how the aspects might work out for you. Enjoy x

CAG as a DNA Mutation Hex 18 Nine Star Ki 4/8 Huntington’s Disease

 Here we have the Pair of Hexagrams associated with CAG 4/8 Hexagram 18 and its partner Hexagram 17 GTC....

In this pairing we have Hex 18 CAG Nine Star Ki 4/8 at the top of the box........with Hexagram 17 GTC Nine star ki 3/7 at the bottom. 

CAG causes problems by repeating itself. 

Lets see what we know....

This is the DIAMOND crystal crystals usually contain 12 codons except the double with contains 24 codons and the diamond which contains only four. See below how its sits neatly at the centre of a record of life........

In the Record of Life all 64 codons sit around the circle including the centre Diamond crystal but the Diamond crystal contains only 4 codons...........CAG is one of them and it has a habit of repeating itself which causes problems with Huntington’s disease.......could the CAG codon want to repeat itself in order to make up the missing 8 codons from its crystal. 

CAG DNA Codon - 4/8 Nine Star Ki - Glutamine Amino Acid - Hex 18 - Direction North to South - Diamond Crystal - D# F A# Music - Jupiter Saturn - 60 x 150 x 150 - The Magician - Hydrophilic

CTG DNA Codon - 3/7 Nine Star Ki - Valine Amino Acid - Hex 17 - Direction North to South - Diamond Crystal - D E B Music - Jupiter Venus - 60 x 150 x 90 - Teacher - Hydrophobic

There are no ALERTS in this mix. CTG sits with CAG in the Diamond Crystal even in the usual codon format they fit together:

            G        C

            T        A

            C        G

The hexagram with the even number 18 is read upwards and the hexagram with the odd number 17 is read downwards.

Nine Star Ki numbers 4 and 7 match as do 3 and 8 so no problem with Nine Star Ki. 

They have different amino acids Glutamine and Valine 

Hexagrams 17 and 18 are a pair

Both take the same direction sitting in the North facing South

Musically CAG lowers half a note from D# to D..... F reduces one note down to E.....A# raises half a note to B.........total is CAG is lowered by one whole note to become CTG.

Planets...they both share Jupiter but CGA has Saturn and CTG is Venus

Aspect shapes have CAG as The Magician and CTG is the Teacher. The Magician is a whole 360* shape whereas The Teacher forms only a 300* pattern.

The Teacher aspect shape is scalene with three lines all different lengths and angles. It is also a hyperbolic triangle as the measurements add up to less than 360* and Obtuse. 

CAG is hydrophilic and loves water........CTG is hydrophobic and avoids water. 

CAG is a DNA Codon we all have about 20 to 30 of but when we find more than that e.g. 36 -121 then there is a problem with Huntington’s Disease. The more it repeats CAG the more likelihood of you getting Huntington’s disease. 

DNA Codons in the crystals can be reduced and increased in size changing a crystal with 36 letters into just 12 letters and then you can expand it outwards again to get the 12 codons. I cannot show you that here because this Diamond crystal has only four codons and cannot be much changed but lets try.

                            TCA CAG AGT GTC Expanded - we can see from the expanded version 12 letters

                                                                Make up 4 codons - associated with Jupiter’s expansion

                            TCAG                         Reduced - now it has been reduced and we have only 4 letters            

                                                                Associated with Saturns reduction 

                                            

To re-expand the reduced codon we read the first three letters TCA then we return to the C and get CAG then we return to the A and get AGT (its on a loop so the next letter after G is T) then we return to G and get GTC - and we are back to the expanded versions of TACCAGAGTGTC.

I mention the reduction of Saturn and expansion of Jupiter here only because the Missense of the CAG mutation is all about repeating the letters over and over again. The other three codons do not have any such problems though so perhaps there is no connection. 

So with this mutation in HD there is no problem with the DNA Codon other than it repeating itself.....nothing else seems to cause a problem as nothing changes the CAG Codon other than its desire to expand. This expansion can cause neurodegeneration in the central nervous system. When you create a long line of Glutamine it becomes a sticky chain which wants to adhere to molecules or more than it normally would gumming up the movement of proteins through the cell impairing the transportation of Huntingtons disrupting metabolism and other cellular functions. Excess sequences do not usually translate into proteins.

Glutamine GLU making things sticky in HD...............if this sticky glue makes molecules stick together it makes it difficult for them to function normally. 

CAG is associated with C - Cancer in the 4th house of Breasts - A Virgo in the 6th house of Intestines and G Aquarius in the 11th house of circulation. Associated with Water, Earth and Air elements. 

            CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

These repeats do create the vision of CAG but also AGC.....7/1 - Serine also a hydrophilic Magician but the amino acid is serine.............it would take only the absence of the first C to change the line completely. Would serine add to the problem? 

Lots to think about enjoy x 

                           

            

Sickle Cell Anaemia and DNA Codon Mutations

This is the Hexagram pairing that is involved in the mutations caused in sickle cell anaemia. In a string of proteins 147 codes long the sixth codon in the chain should be Glutamic Acid but for some reason it has been changed to Valine by the substitution of the T in GTG being made into an A producing GAG which is Glutamic acid. Lets take a look at this particular pair of Hexagrams. 

The top of the shape is GAG and the bottom of the shape is GTG.

GTG     9/6    Hex 13    NE/SW     Mars Venus    8/4 Crystal    D E A#    Alternator    Hydrophobic

                                      Valine                                                                  60 x 180 x 120 

GAG    6/9    Hex 14    SW/NE      Venus Mars    8/4 Crystal    D F A#    Lecturer       Hydrophilic

                                      Glutamic Acid                                                    90 x 150 x 120                                                                                                                     

From this pair of Hexagrams we see that GTG and GAG are closely connected and sit alongside each other in the 8/4 crystal. Just one letter changes GAG  to GTG. The nine star ki numbers are simply reversed 6/9 and 9/6. GAG takes a South West to North East direction and meets up with GTG coming the other way from North East to South West. I feel that this creates a push me pull me effect and keeps the molecule in motion. They share the planets Venus and Mars but again one is Venus and Mars and the other Mars and Venus. Musically they are the same first note D but then F and E are one whole note apart then the last musical notes are both A# so remain the same. Only that middle note changes by one whole note up or down the scale. GTG Valine 9/6 is on the right hand column of the I Ching and is usually a harmonious and balance sound but in this particular case it seems to cause many problems. It has gone from water loving to water fearing. 

GTG is an Alternator in aspect shape ...60 x 180 x 120

This shape starts in the 3rd Astrological house connected to the nervous system of Gemini an Air sign is sextile 60* to Leo in the 5th house (connected to the heart) a fire sign which is 180* to 11th house (connected to circulation) of Aquarius another air sign, in turn it creates a 120* trine aspect back to Gemini in the 3rd. So 3rd house gemini is about communications......5th house of Leo is about creativity and the 11th house of Aquarius is about liberty, freedom and your hopes and dreams. This shape is two blue lines of harmony and one red line of activity which means it lacks green energy and perhaps acts before it thinks.......maybe it can be a bit too laid back and is either working or resting in balance and harmony, switching between one and the other. 

Bodily it connects to the nervous system...the heart...circulation. 

GAG is a Lecturer in Aspect Shape... 90 x 150 x 120 

This shape starts in the 3rd astrological house of (connected to nervous system) Gemini an Air sign and is square to Virgo in the 6th house (connected to intestines) of Earth which in turn is in 150* aspect to 11th house of (connected to circulation) Aquarius another air sign.....then back to Gemini with a trine aspect. So 3rd house of communications....6th house of health and work....11th house of Liberty, Freedom and your hopes and dreams. We have a red, green and blue line in this shape which gives it all types of energy....thinking, acting and manifesting. 

Bodily it connects to the nervous system...the intestines...the circulation. 

So we are changing from Glutamic Acid GAG and its nervous system, intestines and circulation to GTG and its nervous system, heart and circulation. The focus is on the heart now not on the intestines. 

This is how the 8/4 Crystal which they both belong to appears it starts in the East AC at TGA and we see GTG in the 12th house position of hidden enemies with GAG in the 2nd house position of self esteem. The 12 codons that appear here belong to this crystal. I don’t know if they all appear in the 147 proteins associated with SCA

GTG is Hydrophobic and GAG is Hydrophilic meaning GTG likes to sit on the inner rim of a DNA Helix and GTG prefers to sit on the outside. This must mean that the very shape of the helix is being pulled in the opposite direction to its original position. 

When Valine is substituted it makes the haemoglobin molecules stick together forming long fibres that distort the shape of the red blood cells and this brings on an attack. This mutation is destructive to the red blood cells leading to oxygen being unable to bind properly and thus it curves out of shape. 

Some amino acids are hydrophobic and some are hydrophilic in some cases when a pair of Hexagrams don't match up one of them might need to become neutral so it can adapt to the situation it finds itself in, this doesn’t apply here as they are one philic and one phobic but the fact that all others will do the same must be important to the overall situation. 

The sugar phosphate backbone of DNA is hydrophilic and likes to be close to water.  The interior part of the DNA is hydrophobic and likes to stay dry on the inside.

Is it a coincidence that all Hexagram pairings match philic with phobic or one or both of them are neutral too. 

So GAG Glutamic Acid goes from being hydrophilic and water loving to being GTG Valine hydrophobic and avoiding water......perhaps the dehydration causes the folding of blood cells through being less hydrated. We also go from being on a sugar phosphate backbone of DNA which loves water and sits on the outer edge of the helix to a hydrophobic one that prefers to be on the inside staying dry. 

Bear in mind there are two versions of glutamic acid GAG as we see here and GAA but only one of them has an effect on SCA. 

There are four variations on Valine GTT GTC GTA and GTG only GTG has a connection here. I mention this to point out that even amino acids vary in one way or another from each other. 

On researching these facts I find that a contact angle of 90* or less than is classed as philic and any angle over 90* or more than is classed as Phobic. I guess when half of a shape is attracted to water and half isn’t it creates a balance its when you have too much less than or too much more than that problems can occur. As in most things in life balance rules. 

Here we see the I Ching Lines relating to these Amino Acids we see GTG which is Valine and dominates with Fire number 9 and the Glutamic Acid dominates with the number 6 Metal. The Letter A focussing on Earth energy and the letter T focussing on Fire energy. Perhaps the addition of fire to the mix creates something that is hydrophobic and drying out the codon whereas GAG is hydrophobic and does not mix well with water. Also the intestines associated with the A is replaced by the T or pumping heart along with the first G nervous system and final G Circulation.