CAG as a DNA Mutation Hex 18 Nine Star Ki 4/8 Huntington’s Disease

 Here we have the Pair of Hexagrams associated with CAG 4/8 Hexagram 18 and its partner Hexagram 17 GTC....

In this pairing we have Hex 18 CAG Nine Star Ki 4/8 at the top of the box........with Hexagram 17 GTC Nine star ki 3/7 at the bottom. 

CAG causes problems by repeating itself. 

Lets see what we know....

This is the DIAMOND crystal crystals usually contain 12 codons except the double with contains 24 codons and the diamond which contains only four. See below how its sits neatly at the centre of a record of life........

In the Record of Life all 64 codons sit around the circle including the centre Diamond crystal but the Diamond crystal contains only 4 codons...........CAG is one of them and it has a habit of repeating itself which causes problems with Huntington’s disease.......could the CAG codon want to repeat itself in order to make up the missing 8 codons from its crystal. 

CAG DNA Codon - 4/8 Nine Star Ki - Glutamine Amino Acid - Hex 18 - Direction North to South - Diamond Crystal - D# F A# Music - Jupiter Saturn - 60 x 150 x 150 - The Magician - Hydrophilic

CTG DNA Codon - 3/7 Nine Star Ki - Valine Amino Acid - Hex 17 - Direction North to South - Diamond Crystal - D E B Music - Jupiter Venus - 60 x 150 x 90 - Teacher - Hydrophobic

There are no ALERTS in this mix. CTG sits with CAG in the Diamond Crystal even in the usual codon format they fit together:

            G        C

            T        A

            C        G

The hexagram with the even number 18 is read upwards and the hexagram with the odd number 17 is read downwards.

Nine Star Ki numbers 4 and 7 match as do 3 and 8 so no problem with Nine Star Ki. 

They have different amino acids Glutamine and Valine 

Hexagrams 17 and 18 are a pair

Both take the same direction sitting in the North facing South

Musically CAG lowers half a note from D# to D..... F reduces one note down to E.....A# raises half a note to B.........total is CAG is lowered by one whole note to become CTG.

Planets...they both share Jupiter but CGA has Saturn and CTG is Venus

Aspect shapes have CAG as The Magician and CTG is the Teacher. The Magician is a whole 360* shape whereas The Teacher forms only a 300* pattern.

The Teacher aspect shape is scalene with three lines all different lengths and angles. It is also a hyperbolic triangle as the measurements add up to less than 360* and Obtuse. 

CAG is hydrophilic and loves water........CTG is hydrophobic and avoids water. 

CAG is a DNA Codon we all have about 20 to 30 of but when we find more than that e.g. 36 -121 then there is a problem with Huntington’s Disease. The more it repeats CAG the more likelihood of you getting Huntington’s disease. 

DNA Codons in the crystals can be reduced and increased in size changing a crystal with 36 letters into just 12 letters and then you can expand it outwards again to get the 12 codons. I cannot show you that here because this Diamond crystal has only four codons and cannot be much changed but lets try.

                            TCA CAG AGT GTC Expanded - we can see from the expanded version 12 letters

                                                                Make up 4 codons - associated with Jupiter’s expansion

                            TCAG                         Reduced - now it has been reduced and we have only 4 letters            

                                                                Associated with Saturns reduction 

                                            

To re-expand the reduced codon we read the first three letters TCA then we return to the C and get CAG then we return to the A and get AGT (its on a loop so the next letter after G is T) then we return to G and get GTC - and we are back to the expanded versions of TACCAGAGTGTC.

I mention the reduction of Saturn and expansion of Jupiter here only because the Missense of the CAG mutation is all about repeating the letters over and over again. The other three codons do not have any such problems though so perhaps there is no connection. 

So with this mutation in HD there is no problem with the DNA Codon other than it repeating itself.....nothing else seems to cause a problem as nothing changes the CAG Codon other than its desire to expand. This expansion can cause neurodegeneration in the central nervous system. When you create a long line of Glutamine it becomes a sticky chain which wants to adhere to molecules or more than it normally would gumming up the movement of proteins through the cell impairing the transportation of Huntingtin disrupting metabolism and other cellular functions. Excess sequences do not usually translate into proteins.

Glutamine GLU making things sticky in HD............More GLU in Glutamic acid doing similar in SCA.....if this sticky glue makes molecules stick together it makes it difficult for them to function normally. 

CAG is associated with C - Cancer in the 4th house of Breasts - A Virgo in the 6th house of Intestines and G Aquarius in the 11th house of circulation. Associated with Water, Earth and Air elements. 

            CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

These repeats do create the vision of CAG but also AGC.....7/1 - Serine also a hydrophilic Magician but the amino acid is serine.............it would take only the absence of the first C to change the line completely. Would serine add to the problem? 

Lots to think about enjoy x