CAG as a DNA Mutation Hex 18 Nine Star Ki 4/8 Huntington’s Disease

 Here we have the Pair of Hexagrams associated with CAG 4/8 Hexagram 18 and its partner Hexagram 17 GTC....

In this pairing we have Hex 18 CAG Nine Star Ki 4/8 at the top of the box........with Hexagram 17 GTC Nine star ki 3/7 at the bottom. 

CAG causes problems by repeating itself. 

Lets see what we know....

This is the DIAMOND crystal crystals usually contain 12 codons except the double with contains 24 codons and the diamond which contains only four. See below how its sits neatly at the centre of a record of life........

In the Record of Life all 64 codons sit around the circle including the centre Diamond crystal but the Diamond crystal contains only 4 codons...........CAG is one of them and it has a habit of repeating itself which causes problems with Huntington’s disease.......could the CAG codon want to repeat itself in order to make up the missing 8 codons from its crystal. 

CAG DNA Codon - 4/8 Nine Star Ki - Glutamine Amino Acid - Hex 18 - Direction North to South - Diamond Crystal - D# F A# Music - Jupiter Saturn - 60 x 150 x 150 - The Magician - Hydrophilic

CTG DNA Codon - 3/7 Nine Star Ki - Valine Amino Acid - Hex 17 - Direction North to South - Diamond Crystal - D E B Music - Jupiter Venus - 60 x 150 x 90 - Teacher - Hydrophobic

There are no ALERTS in this mix. CTG sits with CAG in the Diamond Crystal even in the usual codon format they fit together:

            G        C

            T        A

            C        G

The hexagram with the even number 18 is read upwards and the hexagram with the odd number 17 is read downwards.

Nine Star Ki numbers 4 and 7 match as do 3 and 8 so no problem with Nine Star Ki. 

They have different amino acids Glutamine and Valine 

Hexagrams 17 and 18 are a pair

Both take the same direction sitting in the North facing South

Musically CAG lowers half a note from D# to D..... F reduces one note down to E.....A# raises half a note to B.........total is CAG is lowered by one whole note to become CTG.

Planets...they both share Jupiter but CGA has Saturn and CTG is Venus

Aspect shapes have CAG as The Magician and CTG is the Teacher. The Magician is a whole 360* shape whereas The Teacher forms only a 300* pattern.

The Teacher aspect shape is scalene with three lines all different lengths and angles. It is also a hyperbolic triangle as the measurements add up to less than 360* and Obtuse. 

CAG is hydrophilic and loves water........CTG is hydrophobic and avoids water. 

CAG is a DNA Codon we all have about 20 to 30 of but when we find more than that e.g. 36 -121 then there is a problem with Huntington’s Disease. The more it repeats CAG the more likelihood of you getting Huntington’s disease. 

DNA Codons in the crystals can be reduced and increased in size changing a crystal with 36 letters into just 12 letters and then you can expand it outwards again to get the 12 codons. I cannot show you that here because this Diamond crystal has only four codons and cannot be much changed but lets try.

                            TCA CAG AGT GTC Expanded - we can see from the expanded version 12 letters

                                                                Make up 4 codons - associated with Jupiter’s expansion

                            TCAG                         Reduced - now it has been reduced and we have only 4 letters            

                                                                Associated with Saturns reduction 

                                            

To re-expand the reduced codon we read the first three letters TCA then we return to the C and get CAG then we return to the A and get AGT (its on a loop so the next letter after G is T) then we return to G and get GTC - and we are back to the expanded versions of TACCAGAGTGTC.

I mention the reduction of Saturn and expansion of Jupiter here only because the Missense of the CAG mutation is all about repeating the letters over and over again. The other three codons do not have any such problems though so perhaps there is no connection. 

So with this mutation in HD there is no problem with the DNA Codon other than it repeating itself.....nothing else seems to cause a problem as nothing changes the CAG Codon other than its desire to expand. This expansion can cause neurodegeneration in the central nervous system. When you create a long line of Glutamine it becomes a sticky chain which wants to adhere to molecules or more than it normally would gumming up the movement of proteins through the cell impairing the transportation of Huntingtin disrupting metabolism and other cellular functions. Excess sequences do not usually translate into proteins.

Glutamine GLU making things sticky in HD............More GLU in Glutamic acid doing similar in SCA.....if this sticky glue makes molecules stick together it makes it difficult for them to function normally. 

CAG is associated with C - Cancer in the 4th house of Breasts - A Virgo in the 6th house of Intestines and G Aquarius in the 11th house of circulation. Associated with Water, Earth and Air elements. 

            CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

These repeats do create the vision of CAG but also AGC.....7/1 - Serine also a hydrophilic Magician but the amino acid is serine.............it would take only the absence of the first C to change the line completely. Would serine add to the problem? 

Lots to think about enjoy x 

                           

            

Sickle Cell Anaemia and DNA Codon Mutations

This is the Hexagram pairing that is involved in the mutations caused in sickle cell anaemia. In a string of proteins 147 codes long the sixth codon in the chain should be Glutamic Acid but for some reason it has been changed to Valine by the substitution of the T in GTG being made into an A producing GAG which is Glutamic acid. Lets take a look at this particular pair of Hexagrams. 

The top of the shape is GAG and the bottom of the shape is GTG.

GTG     9/6    Hex 13    NE/SW     Mars Venus    8/4 Crystal    D E A#    Alternator    Hydrophobic

                                      Valine                                                                  60 x 180 x 120 

GAG    6/9    Hex 14    SW/NE      Venus Mars    8/4 Crystal    D F A#    Lecturer       Hydrophilic

                                      Glutamic Acid                                                    90 x 150 x 120                                                                                                                     

From this pair of Hexagrams we see that GTG and GAG are closely connected and sit alongside each other in the 8/4 crystal. Just one letter changes GAG  to GTG. The nine star ki numbers are simply reversed 6/9 and 9/6. GAG takes a South West to North East direction and meets up with GTG coming the other way from North East to South West. I feel that this creates a push me pull me effect and keeps the molecule in motion. They share the planets Venus and Mars but again one is Venus and Mars and the other Mars and Venus. Musically they are the same first note D but then F and E are one whole note apart then the last musical notes are both A# so remain the same. Only that middle note changes by one whole note up or down the scale. GTG Valine 9/6 is on the right hand column of the I Ching and is usually a harmonious and balance sound but in this particular case it seems to cause many problems. It has gone from water loving to water fearing. 

GTG is an Alternator in aspect shape ...60 x 180 x 120

This shape starts in the 3rd Astrological house connected to the nervous system of Gemini an Air sign is sextile 60* to Leo in the 5th house (connected to the heart) a fire sign which is 180* to 11th house (connected to circulation) of Aquarius another air sign, in turn it creates a 120* trine aspect back to Gemini in the 3rd. So 3rd house gemini is about communications......5th house of Leo is about creativity and the 11th house of Aquarius is about liberty, freedom and your hopes and dreams. This shape is two blue lines of harmony and one red line of activity which means it lacks green energy and perhaps acts before it thinks.......maybe it can be a bit too laid back and is either working or resting in balance and harmony, switching between one and the other. 

Bodily it connects to the nervous system...the heart...circulation. 

GAG is a Lecturer in Aspect Shape... 90 x 150 x 120 

This shape starts in the 3rd astrological house of (connected to nervous system) Gemini an Air sign and is square to Virgo in the 6th house (connected to intestines) of Earth which in turn is in 150* aspect to 11th house of (connected to circulation) Aquarius another air sign.....then back to Gemini with a trine aspect. So 3rd house of communications....6th house of health and work....11th house of Liberty, Freedom and your hopes and dreams. We have a red, green and blue line in this shape which gives it all types of energy....thinking, acting and manifesting. 

Bodily it connects to the nervous system...the intestines...the circulation. 

So we are changing from Glutamic Acid GAG and its nervous system, intestines and circulation to GTG and its nervous system, heart and circulation. The focus is on the heart now not on the intestines. 

This is how the 8/4 Crystal which they both belong to appears it starts in the East AC at TGA and we see GTG in the 12th house position of hidden enemies with GAG in the 2nd house position of self esteem. The 12 codons that appear here belong to this crystal. I don’t know if they all appear in the 147 proteins associated with SCA

GTG is Hydrophobic and GAG is Hydrophilic meaning GTG likes to sit on the inner rim of a DNA Helix and GTG prefers to sit on the outside. This must mean that the very shape of the helix is being pulled in the opposite direction to its original position. 

When Valine is substituted it makes the haemoglobin molecules stick together forming long fibres that distort the shape of the red blood cells and this brings on an attack. This mutation is destructive to the red blood cells leading to oxygen being unable to bind properly and thus it curves out of shape. 

Some amino acids are hydrophobic and some are hydrophilic in some cases when a pair of Hexagrams don't match up one of them might need to become neutral so it can adapt to the situation it finds itself in, this doesn’t apply here as they are one philic and one phobic but the fact that all others will do the same must be important to the overall situation. 

The sugar phosphate backbone of DNA is hydrophilic and likes to be close to water.  The interior part of the DNA is hydrophobic and likes to stay dry on the inside.

Is it a coincidence that all Hexagram pairings match philic with phobic or one or both of them are neutral too. 

So GAG Glutamic Acid goes from being hydrophilic and water loving to being GTG Valine hydrophobic and avoiding water......perhaps the dehydration causes the folding of blood cells through being less hydrated. We also go from being on a sugar phosphate backbone of DNA which loves water and sits on the outer edge of the helix to a hydrophobic one that prefers to be on the inside staying dry. 

Bear in mind there are two versions of glutamic acid GAG as we see here and GAA but only one of them has an effect on SCA. 

There are four variations on Valine GTT GTC GTA and GTG only GTG has a connection here. I mention this to point out that even amino acids vary in one way or another from each other. 

On researching these facts I find that a contact angle of 90* or less than is classed as philic and any angle over 90* or more than is classed as Phobic. I guess when half of a shape is attracted to water and half isn’t it creates a balance its when you have too much less than or too much more than that problems can occur. As in most things in life balance rules. 

Here we see the I Ching Lines relating to these Amino Acids we see GTG which is Valine and dominates with Fire number 9 and the Glutamic Acid dominates with the number 6 Metal. The Letter A focussing on Earth energy and the letter T focussing on Fire energy. Perhaps the addition of fire to the mix creates something that is hydrophobic and drying out the codon whereas GAG is hydrophobic and does not mix well with water. Also the intestines associated with the A is replaced by the T or pumping heart along with the first G nervous system and final G Circulation. 

The Pairing of Hexagrams in The I Ching

 

This is a Hexagram pairing 47 and 48 of The I Ching......TGC with CGA above they both belong to the 1/1 - 9/9 crystal.......and sit opposite each other in the 3rd and 5th house positions. If I use the I Ching in its usual format T become A at the top and C & G do not change this is a diagonal change.

So TGC becomes CGA with diagonal changes and creates a sextile pattern on the hexagram. If we take the ALERT version of changing bottom and top we would still have TGC at the bottom but the top would become AGC. This also works if you flip the top over from right to left. AGC is also compatible with 1/7.

This would change the hexagrams matching from diagonal to vertical.............I wonder if when DNA changes a T to an A in an error code like sickle cell anaemia does it have a connection to vertical versus diagonal. To be continued on next page. X
 

Alerts of The I Ching amongst The Aspect Shapes

 Note on the last listing that 8 of The I Ching Codons are marked *** which means they are alerts as they do not conform to the normal standard of Hexagram connections.

Take the Hexagram shapes the are made from the DNA Letters in codons....

8 Variations on the triangle make up the 64 codons of DNA G Yellow....Green A .....Blue C.... and Orange T.... they point either North of South. They can create 6 piece Hexagrams....

Simplest GGG changes to CCC diagonally 

When it comes to Hexagrams that contain T and A they swap into each other diagonally but when a hexagram contains C or G as well then only T and A swop. 

As in this example T becomes A and G remains unchanged. 

So that is the standard for DNA Letters matching up in The I Ching. 

One of the Alerts that does not follow this ruling is GCC/CCG

Here we have GCC below and CCG above now in the normal run of things this should be GCC below with GGC above as the C and G should change diagonally. It does not change so it is an ALERT. 

This Hexagram pairing is Hex 51 with 52 which is correct......it is Nine Star Ki matching 3/3 with 8/8 which is also correct so the only problem here is the DNA Letters do not conform to standard. 

GGC/CGG Hexagrams 57 and 58 which is correct....7/7 and 4/4 Nine Star Ki which is correct but again the ALERT here is GGC should become GCC so once again it is the DNA codon letters that are wrong here. 

Here we see the ALERT from ACT with TGA above.....Hexagrams 27/28  so a match there... Nine Star Ki numbers 4/7 and 3/8 above.......now this is not a match......7 and 4 are interchangeable and 8 and 3 are but not combined as they are here so we have an ALERT with the nine star Ki numbers......also the letter of their DNA Codons do not conform either. Instead of T becoming A and C and G remaining unchanged in this combination we see that T and A remain unchanged with C becoming G instead this is an ALERT.So two ALERTS with this combination. 

AGT with TCA are also ALERTS again T and A remain unchanged but C becomes G. The Nine Star Ki numbers are 7/4 and 8/3 which again are not a match so another ALERT here too. The Hexagram numbers are 61 and 62 which is correct. 

So all 8 Codons have a problem what causes the above problems......lets look at ACT if you swop them out in the correct manner you create another ACT on top which obviously wont work. If you take AGT you will once again if done correctly create another AGT on top ..........so it looks as though these four codons got together and decided to swop top hats........just to keep things rolling. 

With the errors in G and C patterns they resolve it differently..........GCC should create the top hat GGC but instead it has been partnered with CCG they have swopped letters vertically rather than diagonally. They partner without problems Hex 51/52 - 3/3 and 8/8. Also GGC has a top hat of CGG when it should be GCC again vertical not diagonal changes. The other C and G dominant codons swop diagonally except for these four. GGC?CGG match with Hex 57/8 and nine star ki 7/7 and 4/4. So just letters are an ALERT here. 

If I look at all 8 of the codons they do in-fact all swop vertically rather than diagonally which is the first time I have realised this. Could there be a reason for them to change vertically rather than diagonally changes which make them ALERTS that cannot be corrected so they make vertical changes instead. Whatever the reasons these eight codons do not conform to the standard of The I Ching for whatever reason and its worthy of note. Enjoy your thinking. X 

The Word 28143976 and its Data and Connections - The I Ching

2          8            1                4                 3                 9             7             6              

CCC        CCT          CTC           CTT            TCC            TCT        TTC        TTT

2-2        2-8          2-1              2-4              2-3           2-9          2-7      2-6     2

Proline   Proline     Leucine    Leucine         Serine        Serine     Pheny    Pheny

Hex 2    Hex 23     Hex 8       Hex 20          Hex 16       Hex 35    Hex 45   Hex 12

Centre   NE/SW    NW/SE      E/W              SE/NW       W/E         S/N         N/S

6/6        6/6          8/4          6/6                Double          8/4        Double      6/6

D#GB    D#GG#   D#EB        D#EG#          C G B         CGG#     C E B      C E G#

Saturn    Saturn    Saturn       Saturn           Saturn         Saturn   Saturn     Saturn

Saturn   Saturn    Mercury    Jupiter            Jupiter          Mars     Venus      Venus

120/    120/      30/          30/          150/              150/    120/    120/

120/    30/      150/          120/      120/              30/    150/    120/

120    150      120          150              30                120          30          120

G Trine Thinker   Thinker     Thinker          Thinker        Thinker   Thinker   G Trine

Phobic  Phobic    Phobic       Phobic      Philic             Philic    Phobic   Phobic

CCA     CCG***    CTA          CTG      TCA***         TCG    TTA    TTG

8-2     8-8      8-1          8-4          8-3              8-9       8-7         8-6    8

Proline Proline      Leucine    Leucine      Serine          Serine     Leucine  Leucine

Hex 15 Hex 52      Hex 39      Hex 53      Hex 62        Hex 56     Hex 31   Hex 33

SW/NE Centre     E/W           S/N               N/S         SE/NW     NW/SE   W/E

Double Double     1/1             8/4          Diamond     Double     Double   6/6

D#GA   D#GA#    D#EA        D#EA#          C G A        CGA#      C E A     C E A#

Saturn Saturn      Saturn       Saturn      Saturn        Saturn     Saturn    Saturn

Saturn  Saturn      Mercury     Jupiter       Jupiter        Mars        Venus     Venus

120/    120/      30/          30/          150/           150/    120/      120/

60/    90/      150/          180/      60/            90/            150/      180/

180    150      180          150            90            60              90      60

Altern    Lecturer   Ruminator Ruminator   Teacher     Teacher    Lecturer  Altern    

Phobic    Neutral      Neutral      Neutral      Neutral        Philic    Phobic    Phobic

     & Phobic & Phobic   & Phobic       

CAC    CAT      CGC          CGT      TAC            TAT    TGC      TGT

1-2     1-8      1-1          1-4          1-3            1-9    1-7      1-6      1

Histidine Hist      Arginine    Arginine      Tyrosine     Tyrosine      Cysteine Cysteine

Hex 7    Hex 4      Hex 29      Hex 59      Hex 40       Hex 64    Hex 47      Hex 6

SE/NW    W/E      Centre          SW/NE      E/W          NW/SE    NE/SW      S/N

8/4     Double    1/1          Double      1/1            1/1     1/1      8/4

D#FB    D#FG#      D#F#B     D#F#G#      C F B          CFG#    CF#B      CF#G#

Mercury Mercury  Mercury   Mercury     Mercury    Mercury   Mercury  Mercury

Saturn    Saturn    Mercury   Jupiter      Jupiter        Mars    Venus     Venus

60/    60/      90/          90/          150/            150/    180/        180/

180/    90/      150/          60/          180/            90/    150/        60/

120    150      120          150            30              120         30        120

Altern    Teacher    Lecturer  Teacher           Ruminator Lecturer    Ruminator Altern

Philic    Philic        Philic          Philic        Neutral       Neutral     Phobic         Phobic

                        Phobic       Phobic   

CAA    CAG      CGA          CGG***      TAA            TAG    TGA***        TGG

4-2     4-8      4-1            4-4        4-3            4-9      4-7         4/6     4

Glutam Glutamine Arginine   Arginine    Stop Ochre Stop Amber Stop Opal Tyrpto

Hex 46  Hex 18      Hex 48     Hex 57        Hex 32      Hex 50      Hex 28    Hex 44

W/E     N/S        NE/SW    Centre        NW/SE      S/N      SW/NE    E/W

Double  Diamond  1/1          Double        Double     Double       8/4        6/6

D#FA    D#FA#     D#F#A    D#F#A#        C F A     C F A#      C F#A        C F#A#

Jupiter    Jupiter        Jupiter     Jupiter      Jupiter         Jupiter      Jupiter        Jupiter

Saturn    Saturn        Mercury   Jupiter      Jupiter         Mars      Venus        Venus

60/    60/        90/        90/            150/            150/      180/        60/

120/    150/        90/        120/      120/            150/      90/        120/

180     150        180         150        90              60      90        180

Altern    Magician   Worker    Lecturer        Lecturer      Magician    Worker    Altern

Philic    Philic        Philic      Philic        Neutral       Neutral      Neutral   Phobic

ACC   ACT***    ATC        ATT        GCC***       GCT      GTC        GTT

3-2    3-8        3-1          3-4        3-3              3-9      3-7        3-6      3

309    309        Isoleucine Isoleucine  Alanine       Alanine       Valine     Valine

Hex 24    Hex 27       Hex 3      Hex 42        Hex 51      Hex 21      Hex 17    Hex 25

NW/SE S/N        W/E      SE/NW        Centre       NE/SW       N/S          SW/NE

6/6     8/4        Double     Double        Double      1/1.     Diamond. Double

C#GB    C#GG#        C#EB       C#EG#        D G B    DGG#      D E B        D E G#

Jupiter    Jupiter        Jupiter      Jupiter        Jupiter     Jupiter       Jupiter     Jupiter

Saturn    Saturn        Mercury    Jupiter        Jupiter     Mars      Venus     Venus

180/    180/        90/            90/        150/          150/            60/          60/

120/      30/        150/           120/           120/           30/             150/        120/

60     150        60            150        90             180        90          180

Altern    Ruminator Teacher    Lecturer        Lecturer Ruminator Teacher  Altern

N     N        Phobic      Phobic         Neutral    Phobic     Phobic    Phobic

                                                                     Phobic

ACA    ACG        ATA        ATG        GCA         GCG      GTA       GTG

9/2    9/8        9/1          9/4        9/3          9/9        9/7        9/6      9

309    309        Isoleucine  MET-Start   Alanine    Alanine Valine    Valine

E/W NW/SE SE/NW N/S SW/NE Centre W/E NE/SW

Hex 36   Hex 22     Hex 63       Hex 37        Hex 55     Hex 30      Hex 49  Hex 13

8/4    1/1        1/1              1/1        Double    1/1   Double     8/4

C#GA    C#GA#    C#EA       C# E A#        D G A     D G A#    D E A     D E A#

Mars     Mars        Mars          Mars        Mars      Mars      Mars       Mars

Saturn    Saturn      Mercury    Jupiter        Jupiter    Mars      Venus     Venus

180/    180/        90/              90/        150/        150/         60/        60/

60/    90/        150/            180/        60/          90/      150/        180/

120    90        120            90        150        120      150         120

Altern    Worker    Lecturer       Worker     Magician Lecturer  Magician. Altern

Neutral    Neutral        Neutral   Phobic        Neutral    Phobic        Phobic   Phobic

            Phobic            Phobic

AAC    AAT      AGC          AGT***        GAC        GAT      GGC***   GGT

7-2    7-8      7-1              7-4        7-3         7-9      7-7        7-6      7

Aspara Asparag   Serine         Serine  Aspartic Acid Aspartic A Glycine Glycine

Hex 19    Hex 41    Hex 60        Hex 61        Hex 54    Hex 38   Hex 58    Hex 10

N/S     SE/NW   SW/NE      NE/SW        S/N        E/W      Centre     NW/SE

6/6    Double   Double    Diamond      8/4         1/1      Double    Double

C#FB    C#FG#     C#F#B       C#F#G#       D F B    D F G#      D F#B     DF#G#

Venus    Venus      Venus    Venus        Venus    Venus      Venus     Venus

Saturn    Saturn    Mercury  Jupiter        Jupiter    Mars      Venus    Venus

120/    120/      150/       150/        90/        90/      120/        120/

180/    90/      150/       60/        180/       90/      150/        60/

60     150        60        150        90        180        90        180

Altern    Lecturer   Magician      Magician     Worker    Worker     Lecturer Altern

Philic    Philic       Philic          Neutral        Philic    Philic      Neutral   Neutral

AAA    AAG      AGA              AGG        GAA        GAG        GGA        GGG

6-2    6-8      6-1              6-4        6-3        6-9           6-7        6-6      6

Lysine    Lysine      Arginine   Arginine  Glutamic Ac Glutamic A Glycine Glycine

Hex 11    Hex 26    Hex 5          Hex 9      Hex 34    Hex 14     Hex 43   Hex 1

S/N     E/W      N/S              W/E        NE/SW    SW/NE    SE/NW   Centre

6/6     Double    8/4              Double      6/6        8/4      6/6        6/6

C# FB C#FG#   C#F#B C#F#G#   D F B D F G#    D F# B   D F# G#

Venus    Venus      Venus          Venus        Venus    Venus      Venus    Venus

Saturn    Saturn      Mercury       Jupiter        Jupiter    Mars      Venus    Venus

120/    120/      150/              150/        90/        90/      120/        120/

120/     150/      90/              120/        120/        150/      90/        120/

120    90      120              90        150         120      150        120

G Trine Lecturer Lecturer Lecturer Lecturer Lecturer Lecturer Lecturer

Philic    Philic    Philic          Philic      Philic    Philic    Neutral   Neutral

ALL 64 cODONS OF dna and data connections .

*** All items marked *** are alerts and in some way or other do not conform to the usual standards.