Endometriosis - Thyroid - Hereditary Hemochromatosis DNA Mutations

Endometriosis

Facts:

Tyrosine reduces dopamine levels, Thyroid hormones are derived from Tyrosine.

In Endometriosis Cysteine reads as Tyrosine in error.

Endometriosis occurs when there is a lack of Cysteine in the body and the body is creating tyrosine instead.

Human Hepcidin – a natural iron regulator the absence of which creates a condition known as Hereditary Haemachromatosis which results in high iron levels.

Human Hepcidin is created from Cysteine rich peptides.

In conditions where Cysteine is substituted for Tyrosine the natural iron regulator Hepcidin is not produced.

Cysteine metabolises to Sulphuric Acid which detox's the system.

Cysteine breaks down mucus making it thinner and easier to cough up. (Is there a lack of Cysteine with the condition Cystic Fibrosis?)

Observations:

I come from a family that has the potential to get thyroid problems, my body may well produce Tyrosine to help and this in turn creates Thyroxine and keeps Thyroid problems at bay. The accidental result could be lack of Cysteine creating Endometriosis. That same lack of cysteine could mean that my natural iron regulator in the form of Hepcidin is not being made.

I come from a family history which is part Irish and part German. The German part of the family are more prone to Thyroid problems. I have heard if you live in a country that does not have a water boundary it can lack Iodine from the sea in the air and cause Thyroid problems over many generations. So I have the potential for Thyroid problems but I don't have the problem. Yet.

I also have an Irish background and the condition Hereditary Hemochromatosis is common amongst the Irish and can be found in DNA some 4,000 years ago mutating so that it could asborb the little iron they had. Of course once their diets returned to normal the mutation remained and the body stores more iron than is necessary and the condition Hereditary Hemochromatosis was born. Oddly Cystic Fibrosis is also highly prevalent in Ireland along with lactose intolerance. All mutations many thousands of years old. 

So from my German background my body changes the production of Cysteine to Tyrosine in order to correct my potential for Thyroid problems, which in turn creates the health problem Endometriosis through lack of Cysteine, which in turn creates my Hereditary Hemochromotosis problems again from lack of cysteine. So perhaps if I found a way to add Cysteine to my body I would not have had H.H or Endometriosis but could well have had Thyroid problems.

It would appear my mutations were trying to help my combined German/Irish background and ended up causing me health problems. DNA always has good intentions. 

As an update since writing this I have had surgery to correct the endometriosis......and yes I now have thyroid problems. X

Map 806 The N.E. Corner of the Feng Shui Map

We are often told in Feng Shui that the bottom left hand corner should be treated as though it was not there. The number 8 white position in the N.E. of the chart. I took this image and because the N.E. snow capped mountains area is white it appears to have vanished of its own accord. Perhaps it makes us snow blind and we just cant see what's hidden there. There is a piece of the jigsaw in this picture but because it is white and caught the flash of the camera it cannot be seen. I wonder what other hidden gems we fail to see.

Magic Hey !

Map 805 The Star of David in The I Ching

Map 804 Face on I Ching Nine Star Ki Wall and Its side partner

1/1 Crystal

1/1 - A

                                                       3/9 - B 9/8 - C

                                                       1/8 - D 3/1 - E

                                                       1/9 - F 9/1 - F

                                                       9/4 - E 7/9 - D

                                                       1/7 - C 4/1 - B

                                                           9/9 - A

This is the nine star ki associated with the 1/1 crystal note the connections between the numbers. If I build a face on brick walk in nine star ki shaped bricks the side of the wall will match up as above. So 1/1 face on is 9/9 on the side. 

Map 803 Amino Acids Required to make Oxytocin

Pituitary Gland

To make Oxytocin a hormone secreted by the posterior pituitary gland nine amino acids are required, its only 8 variations as Cysteine is used twice.

Cysteine TGC 1/7 Hex 47 NE/SW 1/1 C F# B Mercury/Venus

Aspect shape 180 x 150 x 30

Tyrosine TAC 1/3 Hex 40 E/W 1/1 C F B Mercury/Jupiter

Aspect Shape 150* X 180* X 30*

Isoleucine ATT 3/4 Hex 42 SE/NW Double C# E G# Jupiter/Jupiter

Aspect Shape 90* x 120* x 150*

Glutamine CAG 4/8 Hex 18 N/S Diamond D# F A# Jupiter/Saturn

Aspect Shape 60* x 150* x 150*

Asparagine AAC 7/2 Hex 19 N/S 6/6 C# F B Venus/Saturn

Aspect Shape 120* x 180* x 60*

Cysteine TGC 1/7 Hex 47 NE/SW 1/1 C F# B Mercury/Venus

Aspect shape 180 x 150 x 30 

Proline CCC 2/2 Hex 2 Centre 6/6 D# G B Saturn/Saturn

Aspect Shape 120* x 120* x 120* Grand Trine in water

Leucine CTG 8/4 Hex 53 S/N 8/4 D# E A# Saturn/Jupiter

Aspect Shape 30* x 180* x 150*

Glycine GCG 9/9 Hex 30 Centre 1/1 D G A# Mars/Mars

Aspect Shape 150* x 90* x 120*

It acts as a neuromodulator of the brain. Something so important can be made by just a string of 9 amino acids. Interestingly both Cysteine's are TGC rather than TGC and the other Cysteine TGT. So obviously the sequence of amino acids is important, it is not a recipe where you throw the amino acids into a dish and mix or we would just have a measure of each and two measures of cysteine.

The second cysteine can only be added to the mix at point 6.

TGC TAC ATT CAG AAC TGC CCC CTG GGC

Required at the time of birth and then for the production of milk. Suckling children stimulate the pituitary gland which releases this hormone which causes the muscle cells around the gland to contract and release milk. Maybe both mother and child benefit from breast feeding.

There are also tests now for bulls and cows to see which bulls are likely to produce female calves and which cows are the best milkers. Is this Eugenics for cattle, is it wise? I realise this is business and why produce to destroy but it's a very alarming view. Although when I read about young bulls short lives I am leaning towards a level of understanding.

What do we have from this string of DNA.....

TGC TAC ATT CAG AAC TGC CCC CTG GGC

9 Codons ….. 4 from the 1/1 crystal... 2 from the 6/6 Crystal...1 from the 8/4 Crystal...1 from the diamond crystal and 1 from the double crystal.

So the 1/1 crystal dominates here but all crystals are present.

3 Mercury... 3 Venus....5 Jupiter...5 Saturn...2 Mars...

Jupiter planet of expansion and Saturn planet of restriction strongest here but what a contradiction to expand and contract.

2 NE/SW directions...1 E/W...1 SE/NW...2 N/S...1 S/N...2 Centre...

No clear dominant in the directions chart but NE/SW and centre have two markers.

Musical tones...

3 C...2 C#...1 D...3 D#...2 E...3 F...2 F#...2 G... 1 G#... 3 A#... 5 B...

B is the dominant sound in this string of amino acids. The end.

I will think some more on this I have so longed for a string of amino acids that I could read and think about. x

Map 802 Birthcharts built from DNA and Nine Star Ki

Perhaps the five variations of crystals give us five variations of man. The 6/6 crystal, the 1/1, 8/4, the double largest crystal and finally the diamond smallest crystal. 6/6 and 1/1 have a relationship, the double relates to its own other half and the 8/4 and diamond crystal are attracted to each other.

So next time you set up a birth chart just remember you need to find out which crystal you belong to before you start adding those planets, or opportunities for mutation and change.

So people born with the DNA letters that belong to the 6/6 crystal above would use this as their template. First house AAA, a year number 6 born in February, May or  November. Interestingly AAA produces 6/5 and as five does not exist in The I Ching world it is changed to either a 2 AAA or 8 AAG. Perhaps not the best example to have chosen but it is what it is. So only males can become AAA which is not something I had previously given any thought to.

Other DNA codons in the 6/6 crystal would be 6/6, 4/6, 8/6, 2/6, 2/4, 2/8, 2/2, 3/2, 7/2, 6/2, 6/3, 6/7,  all of which could be added to the template above. CCC would be the 4th house, TTT would be the 7th house and GGG would be the 10th house. No surprise their that the Heavenly energy of GGG would belong to the house of the C.E.O. (Chief Executive Officer).

Now we look for the same information in the 1/1 crystal.  The first house is now TAT which belongs to someone born in a 1 year during October a Nine star ki of 1/9/6. So We can see that TAT has a connection to AAA only because they both belong to the first houses of their templates. Others with the following nine star ki numbers would belong to this crystal. 1/1, 9/8, 1/3, 9/1, 7/9, 4/1, 9/9, 1/7, 9/4, 1/9, 8/1 and 3/9.

So First house TAT, 4th house GCG, 7th house ATA and finally 10th house CGC.

Now we can see that to start your birth chart you need to know which chart you belong to. The same rules apply to the other crystals which you can trace the DNA letters of via previous maps. For me my chart template is the 1/1 crystal above.

Template of the 1/1 Crystal

My birth Chart for 1/7/8

15^th, March, 1954

1^st house – TAT – 1/9 – 64 Hexagram

2^nd house – ATG – 9/4 + 37 Hexagram

3^rd house – TGC – 1/7 + 47 Hexagram

4^th house – GCG – 9/9 - 30 Hexagram

5^th house – CGA – 4/1 – 48 Hexagram

6^th house – GAT – 7/9 – 38 Hexagram

7^th house – ATA – 9/1 + 63 Hexagram

8^th house – TAC – 1/3 – 40 Hexagram

9^th house – ACG – 9/8 – 22 Hexagram

10^th house – CGC – 1/1 + 29 Hexagram

11^th house – GCT – 3/9 + 21 Hexagram

12^th house – GCT – 3/9 + 21 Hexagram

So each section gives you a three letter codon. Take the 1^st house of TAT and then look at the three outer, middle and inner rings of the circle and you will see that TAT runs through them too. In fact all the 12 codons repeat themselves over and over again throughout the template.

So my TGC belongs to the 3^rd house but can also be found in the outer edge of the 3^rd, 4^th and 5^th houses, the 2^nd, 3^rd and 4^th of the middle circle and in the 1^st, 2^nd and 3^rd houses of the inner circle.

Four different representations of TGC within one circle but all active between the 1^st, 2^nd, 3^rd, 4^th and 5^th houses. The dominant one is at the centre or in the 3^rd house.

1 2 3 4 5

All working between the 1^st and 2^nd quadrants. So these must be more dominant for me.

Within those first five houses there are 4 fire T symbols, 3 earth A symbols, 5 G air/tree symbols and 3 C water symbols. So air/tree dominates G, followed by fire T and a joint count of 3 for water and earth.

The above are the positions of the sun signs with Aries as the starting point at house one. The usual house positions need not apply here. So the planets above would be positioned in the codons that apply to this particular crystal.

I have Venus in my 1^st house, empty house 2^nd, Jupiter 3^rd house, Uranus 4^th house and Moon in 5^th house. So I suspect they will be important to me as they all have some connection with my TGC. Clearly the most important planet is Jupiter as it is in the 3^rd house of TGC.

So the first TGC is very close to the centre and smaller in size as it spans the 1^st, 2^nd and 3^rd house.

It becomes marginally more prominent as it spans the middle circle TGC across houses 2,3 and 4.

TGC that is on the outer circle is the biggest and most dominant as it spans houses 3,4 and 5. So whilst Venus is strong in the first my most dominant planets are Jupiter, Uranus and the Moon. Don't forget that TGC spans the whole of the 3^rd house so without a doubt Jupiter is the most prominent of all. For that I have always been grateful. No time for boredom as another idea will be along in a moment. I think this blog tells you a lot about what you need to know about me and my dominant features.

Map 801 Nine Star Ki Variations

Variations on a Theme of Nine Star Ki

 

 

If they cuddle up together they can save space into infinity and beyond. Happy New Year. 

Map 800 DNA Bases and Their colours

Having watched the Royal Institute Christmas Lectures I make the following observations:

Astrology and DNA

I cant help but wonder how the colours of the bases of DNA in science became as follows:

T – Thymine – Yellow – Fire

G – Guanine – Green – Air/Tree

A – Adenine – Blue - Earth

C – Cytosine – Orange Red - Water

I find it hard to believe that the colours above match well with the elements they represent. I know science tries its hardest to stay away from astrology and its elements of Fire, Earth, Air and Water but is this a deliberate distraction.

For me the following fits much better:

T – Thymine – Orange – Fire

G – Guanine – Yellow – Air/Tree

A – Adenine – Green – Earth

C – Cytosine – Blue – Water

 This is an image of the 6/6 Crystal as a wheel or astrology type chart:

It shows how in area one, Earth, some of it is still coming from the past yellow area (air) and some is moving into the future blue area (water). In this particular case the 6/6 crystal is very neat and orderly as one would expect of Heavenly energy but if we look at the next one the 1/1 crystal is now much more dispersed that the 6/6.

 

The 1/1 crystal has now spread itself about more. My own DNA reference TGC can be seen in the 3rd house of communications.
So I think not to connect, Astrology with the I Ching and The I Ching with DNA, and DNA with Nine Star Ki and so on would be a missed opportunity.
In particular in the cases of different base codes which make the same amino acid e.g. CCC and CCT both make Proline.
With more choices CCC can also be described as Proline... Hexagram number 2...Hexagram word Earth...musical tones D# G B... Nine star Ki 2/2... Position centre... Binary 000000... Element Earth/Earth... Planets Saturn/Saturn... Shape Grand Trine in Water... Houses and signs Cancer 4th, Scorpio 8th, Pisces 12th...I Ching Lines Jin, Jin, Jin, Jin, Jin, Jin...belongs to the 6/6 Crystal in the IC bottom peak position...First C Cancer chest...second C Sexual organs...third C feet.
Now the same amino acid must be different in some way and CCT makes Proline...Hex number 23...Hexagram Words Strip Away...musical tones D# G G#...Nine Star Ki 2/8...NE sitting SW facing position...Binary 000001...Element Earth/Earth...Planets Saturn/Saturn... Shape 120* x 30* x 150*... Houses Cancer 4th - Scorpio 8th...Sagittarius 9th...I Ching Lines Jin, Jin, Jin, Jin, Jin, Jang...belongs to the 6/6 crystal in the 5th house position... First C chest...second C Sexual organs... third T Liver.
So they both make Proline but they have differences which could mean they make Proline in a specific area of the body. CCT moving to the Liver whilst CCC heading for the feet. All food for thought and as much thought as we can muster is the best so please don't discount the old ways in favour of the new which in a lot of cases has come via spiritual routes. If looking at The I Ching can produce over 800 blog pages it has to be worth a peek.

If not looking at astrology is something you like to mention then you are no Einstein.  Enjoy your thoughts. x

Map 799 Amino Acids and their communications

Good morning I thought I should communicate with you in a DNA manner and thus have left you the following message.

CACGCCCCCCCTTACTAAAACGAATGGTAGTATGAGGCTAGATGA

If you cannot fathom it try Map 14 for a little help. x

Map 798 36 Triangles of Solo Man's Temple for December, 2013

Solo Man's Temple for December, 2013

I know I said I wouldn't list another 36 Triangles but it is Christmas and I love doing it so much.

This is a game whereby all 64 codons of DNA can be read in the pattern of 36 triangles. Of course there can be more than 36 triangles but I have found the lowest amount of triangles that can contain all 64 codons hidden amongst it to be 36.

Give it a try you will soon be hooked. As you don't have the game you can either make one on your word program from colored triangles or just write down the letters of the colours T for Orange G for Yellow A for Green and C for Water. Or use a felt tip pen to colour in the shapes.

When you think you have included all DNA count up your triangles and then try to reduce them down to 36.  Then check them against the list below as is often the case you may find you have used the same letters twice and will have to amend it.  Good luck and enjoy and Merry Christmas x 

 

CCC CCT CTC CTT TCT TTT

CCA CCG CTA CTG TCA TCG TTA TTG

CAC CAT CGC CGT TAT TGT

 CAA CAG CGA CGG TAA TAG TGA TGG

ACA ACG ATA ATG GCG GTG

AAA AAG AGA AGG GAG GGG

This is the 64 codons reduced taking out any that read the same backwards e.g. CGT is in but TGC is not. 

Of all the thoughts I have had over the years this one is my most perfect. I can pick it up and meditate my way through it anytime the fancy takes me. I hope you enjoy it too. x